All research in this study complies with all relevant ethical regulations. All biohazard protocols were approved by the Environmental Health and Safety of McGill University and the Biosafety Committee of the University of British Columbia (UBC). All animal procedures were approved by the Facility Animal Care Committee (FACC) of McGill University and the Animal Care Committee of UBC, according to guidelines of the Canadian Council on Animal Care Standards (CCAC). Studies on SCCOHT patient tumors were approved by the Institutional Review Board (IRB) at McGill University, McGill IRB # A08-M61-09B, and UBC, IRB# H18-01652.
Data mining and analysis of genome-wide CRISPR screen data
CRISPR/Cas9 knockout screening data were downloaded from the DepMap Public 21Q2 dataset (https://depmap.org/portal/). The genetic background and SMARCA4/2 expression of DepMap cell lines were derived from Cancer Cell Line Encyclopedia. Cell lines were called as SMARCA4/2-dual deficient based on literature references (BIN-67, SCCOHT-1, COV434, TOV112D, OVK18, H1703, A427, H23, H522)13,29,36,68 or if the cell lines exhibited low gene expression (Log2(TPM + 1) < 3) of SMARCA2 and exhibited damaging mutations on SMARCA4 (see Supplementary Data 1). Differential dependency was calculated by comparing CERES scores between SMARCA4/2-dual deficient cell lines versus proficient lines. Cell lines with SLC38A2 mutation were excluded. Significance was assessed using unpaired two-tailed t-test.
Cell culture
293 T cells were cultured with DMEM (Dulbecco’s modified Eagle medium, Thermo Fisher Scientific, Cat# 11995-065) containing 7% fetal bovine serum (Sigma, Cat# F1051), 1% penicillin/streptomycin (Thermo Fisher Scientific, Cat# 15140-122), and 2 mM L-glutamine (Thermo Fisher Scientific, Cat# 25030-081). All other cell lines were cultured in RPMI (Roswell Park Memorial Institute 1640 Medium, Thermo Fisher Scientific, Cat# 11875-093; no pyruvate) with 7% fetal bovine serum (Sigma, Cat# F1051), 1% penicillin/streptomycin (Thermo Fisher Scientific, Cat# 15140-122), and 2 mM L-glutamine (Thermo Fisher Scientific, Cat# 25030-081). Cells were maintained at 37 °C in a humidified 5% CO2-containing incubator and a regular Mycoplasma test was performed using Mycoalert Detection Kit (Lonza, Cat # LT07-318). OVCAR4: Dr. E. Wang (University of Calgary, Calgary, originally from NCI); BIN-67: Dr. B. Vanderhyden (Ottawa Hospital Research Institute, Ottawa) originally from Dr. S.R. Goldring (Hospital for Special Surgery, New York, originally derived from patients with ovarian carcinoma treated at the Dana-Farber Cancer Institute (Boston, MA)); SCCOHT-1: Dr. R. Hass (Medical University Hannover, Hannover, generated by Dr. R. Hass); PC9: Dr. R. Bernards (Netherlands Cancer Institute, Amsterdam, originally from Immuno-Biological Laboratories (IBL), Tokyo, Japan); OVCAR8, SKOV3: Dr. M. Witcher (McGill University, Montreal, originally from ATCC); IOSE80: Dr. N. Auersperg (The University of British Columbia, Vancouver); FT237, FT190: Dr. T.G. Shepherd (The Mary & John Knight Translational Ovarian Cancer Research Unit, Ontario, FT190 was originally provided by R. Drapkin, University of Pennsylvania, Philadelphia, PA); 293 T: ATCC, CRL-3216; H1703: ATCC, CRL-5889; H1299: ATCC, CRL-5803; H1437: ATCC, CRL-5872; HCC827: ATCC, CRL-2868; A549: ATCC, CCL-185; H2030: ATCC,CRL-5914; H1568: ATCC,CRL-5876; H661: ATCC,HTB-183; H23: ATCC, CRL-5800; A427: ATCC, HTB-53; H522: ATCC, CRL-5810; H358: ATCC, CRL-5807; H441: ATCC, HTB-174; H1792: ATCC, CRL-5895; H1573: ATCC, CRL-5877; COV434: Sigma, 07071909; TOV-112D: Anne-Marie Mes-Masson (Centre de recherche CHUM et; Institut du cancer de Montréal); CaOV3: Dr. Nelly Auersperg (University of British Columbia, Vancouver, originally from Jorgen Fogh, MSKCC); OVCAR3, OVCAR4 and OVCAR5: Dr. Nelly Auersperg (University of British Columbia, Vancouver, originally from Thomas C Hamilton, Fox Chase Cancer Centre). All cell lines have been validated by Short-Tandem Repeat profiling.
Compounds and antibodies
IACS-010759 (S8731), CB839 (S7655), oligomycin A (S1478), rotenone (S2348), BAY-876 (S8452), and cisplatin (S1166) were purchased from Selleck Chemicals (Houston, Texas, USA). Alanine (550-001-EG) was obtained from Wisent Bio (Montreal, QC, Canada). 13C5-Glutamine (CLM-1822), 13C6-Glucose (CLM-1396), were from Cambridge Isotopes Laboratories (Tewksbury, MA). Metformin (#13118) and Phenformin (#14997) were from Cayman Chemical (Ann Arbor, MI, USA). Dimethyl-α-ketoglutarate (DMKG, #349631) was from Sigma (Oakville, ON, Canada). Caspase3/7 green dye (4440) was from Sartorius (Goettingen, Germany). Antibodies against HSP90 (H-114, 1:1,0000) and β-Actin (Cat# sc-47778, 1:1,0000) were from Santa Cruz Biotechnology (Dallas, TX, USA); antibodies against cleaved PARP (Cat# 5625, 1:1,000) and SMARCA2 (Cat# 11996, 1:1,000) were from Cell Signaling (Danvers, MA, USA); antibody against SMARCA4 (A300-813A, 1:1,000) and (ab110641, 1:5000) were from Bethyl Laboratories (Montgomery, TX, USA) and Abcam (Tornoto, ON, Canada), respectively; antibody against SLC2A1 (ab15309, 1:1,000) was from Abcam; antibody against SLC38A2 (BMP081, 1:1,000) was from MBL (Woburn, MA, USA). Antibodies for immunohistochemistry are listed in the corresponding method section below.
Plasmids, Lentivirus production and infection
Individual shRNA vectors used were from the Mission TRC library (Sigma) provided by McGill Platform for Cellular Perturbation (MPCP) at McGill University: shSMARCA2#1 (TRCN0000358828); shSMARCA2#2 (TRCN0000020333); shSLC38A2#1 (TRCN0000020241), shSLC38A2#2 (TRCN0000020242), shSLC38A2#3 (TRCN0000020243). sgRNA (ATGGTGCTGACCCCCAGGCCTT) targeting SMARCA4 was cloned into pLentiCRISPRv2 which was from Addgene (Cat# 52961). The GLUT1-eGFP plasmid was a gift from Wolf Frommer (Addgene plasmid #18729). The pLX304-GFP and pLX304-SLC38A2 were obtained from TRC3 ORF collections from TransOMIC and Sigma provided by MPCP. pReceiver control vector, pReceiver-SMARCA2, and pReceiver-SMARCA4 were purchased from GeneCopoeia. pIN20 and pIN20-SMARCA4 were kindly provided by Dr. Jannik N. Andersen (The University of Texas, MD Anderson Cancer Center).
Lentiviral transduction was performed using the protocol as described at http://www.broadinstitute.org/rnai/public/resources/protocols. Briefly, 2.5 × 106 293 T cells were seeded in six-well plate with 2 mL DMEM medium per well. 8 hours later, cells were transfected with indicated lentiviral constructs, the packaging (psPAX2) and envelope (pMD2.G) plasmid by CaCl2. Virus containing medium were collected (24 and 36 h after transfection) and stored at −80 °C. Infected cells (~8 h for infection and ~20 h for recovery) were selected in medium containing puromycin or blasticidin for 2–3 days and collected immediately for the experiments.
Colony formation assays
Single-cell suspensions of all cell lines were counted and plated into 6-well plates at a density of 0.5–8 × 104 cells per well. Cells were cultured in a medium containing the indicated drugs for 10–14 days (refreshed every 3 days). At the endpoints, cells were fixed with 4% formaldehyde in PBS, stained with crystal violet (0.1%w/v in water) and photographed.
Cell viability assays
Cultured cells were plated into 96-well plates (0.5k–6k cells per well) and treated with medium containing the indicated drugs the next day. For Fig. 1a, Extended Fig. 1j, k, n, and Extended Fig. 5a, c, cells were fixed in methanol: acetic acid: water solution (1:1:8) and then stained with 0.5% crystal violet in methanol after 3 days of treatment; the absorbed dye was resolubilized with 10% acetic acid and measured spectrophotometrically at 595 nM; cell survival was calculated by normalizing the absorbance to that of DMSO-treated controls. For all the remaining cell viability assays, cells were cultured for 4–7 days (refreshed twice a week), and cell viability was measured using the CellTiter-Blue® Viability Assay (Promega) by measuring the fluorescence (560/590 nm) in a microplate reader. Relative cell viability was calculated by normalizing the absorbance or fluorescence to that of the vehicle-treated controls after background subtraction. Heatmaps for cell viability were generated with pheatmap (1.0.12).
Protein lysate preparation and immunoblots
Cells were lysed with protein sample buffer, heated at 95 °C for 5 min, and processed with Novex® NuPAGE® Gel Electrophoresis Systems (Thermo Fisher Scientific). For GLUT1 and SLC38A2 detection, unboiled protein lysates were used. HSP90 and beta-actin served as loading controls.
Caspase3/7 staining and IncuCyte imaging
Cells were seeded in 96-well plates (0.5–8k) and treated with different drugs. IncuCyte® live-cell analysis imaging system was used to record images every 4 h. Cell proliferation was determined by phase-contrast images based on cell confluence. For cell apoptosis, caspase-3/7 green dye (Sartorius, Cat# 4440) was added to the culture medium and apoptosis was analyzed based on fluorescent staining of apoptotic cells.
RNA isolation and qRT-PCR
Total RNA was isolated using Trizol (Invitrogen) and converted to cDNAs using the Maxima First Strand cDNA Synthesis Kit (Thermo Scientific). Quantitative real-time reverse transcription PCR (qRT-PCR) was carried out using SYBR® Green master mix (Roche) according to manufacturer protocols. Relative mRNA levels of indicated genes were normalized to the housekeeping gene ACTB. The sequences of the primers used for qRT-PCR are as follows:
ACTB_Forward (Fwd), GTTGTCGACGACGAGCG;
ACTB_Reverse (Rev), GCACAGAGCCTCGCCTT;
SLC2A1_Forward (Fwd), AGGTGATCGAGGAGTTCTAC;
SLC2A1_Reverse (Rev), TCAAAGGACTTGCCCAGTTT;
SLC38A2_Forward (Fwd), TCCTGTTAAGTGGTGTACTGGT;
SLC38A2_Reverse (Rev), CCAGGTGCATTGTGTACCCA;
Transcriptome analysis
Cell lines: RNA-seq data of cell lines with genetic perturbation of SMARCA4/2 used in this study are: BIN-67 cells ± restoration of SMARCA4 or SMARCA2 (GSE11773542,), A427 cells ± SMARCA4 restoration (GSE15102643,), H1944 cells ± SMARCA2 knockdown (GSE14484344,). Sequencing files were downloaded from Sequence Read Archive (SRA) and mapped to the reference human genome sequence (hg38) with STAR (2.6.1c)69. Gene expressions were calculated by Homer70 with Gencode gene annotation GTF file. Differential expression genes were identified with DESeq2 (version 1.19.38)71. The transcriptome data of DepMap cancer cell lines were derived from DepMap and DESeq2 was applied to determine the differential expression genes.
Patient tumors: RNA-seq data of 13 SCCOHT and 21 HGSOC patient tumors were obtained as described previously18,26. RNA-seq read counts of 379 ovarian cancer tumors were obtained from UCSC xena (http://xena.ucsc.edu/). RNA-seq data of 1016 lung cancer tumors were obtained from cBioportal. Sequencing results were processed by following mRNA quantification analysis pipeline of Genomic Data Commons (https://docs.gdc.cancer.gov/Data/Bioinformatics_Pipelines/Expression_mRNA_Pipeline/): first aligning reads to the GRCh38 reference genome with STAR-2.6.0c and then by quantifying the mapped reads with HTSeq-0.6.172.
Mitochondrial respiration and glycolysis measurements
OCR and ECAR experiments were performed using the XFe96 or XFe24 Analyzer apparatus from Seahorse Bioscience. Cells were cultured in 6 well plate, treated with the indicated drugs or vehicle for indicated time. Then treated cells are reseeded (5000 to 40,000 cells/well) on Seahorse XFe96 V3 PET plates (Agilent, 101085-004) or XFe24 plates (Agilent, Cat# 100882-004) the day before the experiment. The next day, the medium was exchanged with RPMI supplemented with either 2 mM glutamine and 10 mM glucose (Mito Stress Test) or 2 mM glutamine (Glycolysis Stress Test) adjusted to pH~7.4. The plates were incubated for 60 min at 37 °C in a CO2-free incubator before loaded on the Seahorse Analyzer. For the mitochondrial respiration test, oligomycin, FCCP, and a mixture of antimycin A and rotenone were injected to a final concentration of 2 μM, 0.5 μM, and 3 μM, respectively. For Extended Fig. 1c, e, the drugs were sequentially added at indicated time point of 20 mins, 40 mins, and 60 mins. For all the remaining mitochondrial respiration assays, the drugs were sequentially injected at indicated time point of 25 mins, 50 mins, and 75 mins. For the glycolysis stress test, glucose, oligomycin, and 2-deoxyglucose were injected to a final concentration of 10 mM, 2 μM, and 100 mM, at indicated time point of 20 mins, 40 mins and 60 mins, respectively. OCR and ECAR values of each cell line were normalized to cell numbers seeded.
Glucose uptake assay
Glucose uptake was determined using the Glucose Uptake-Glo assay (Promega) following the manufacturer protocols. Briefly, cells were seeded in 96-well plates (5000 cells/well) the day prior to the assay. The next day, the medium was removed, washed with PBS, and incubated in 1 mM 2-deoxy-glucose for 10 min at room temperature. Cells were lysed and neutralized before the addition of the kit’s detection reagent. Luminescence was measured on a luminometer.
Metabolite profiling and isotope tracing
Metabolites were profiled at the Rosalind and Morris Goodman Cancer Institute Metabolomics Innovation Resource. For metabolite profiling experiments, cells were plated in RPMI supplemented with 6% dialyzed FBS (Wisent Bio, Cat# 080-950) at ~80% confluency the day before experiments. For isotope metabolic tracing, media was replaced with glutamine- or glucose-free RPMI supplemented with 6% dialyzed FBS and 13C5-glutamine or 13C6-glucose (Cambridge Isotopes Laboratories, Tewksbury, MA) for 1 hr or 0.5 hr, respectively. In addition, dishes were kept in unlabeled media as control. Cells were washed twice in cold saline solution (NaCl, 0.9 g/l) and metabolites were extracted with 1 ml 80% ice-cold methanol (GC/MS grade). After 2 rounds 10 min sets of sonication (30 seconds on/30 seconds off at high intensity) on slurry ice using a Bioruptor UCD-200 sonicator, the homogenates were centrifuged at 14,000 × g at 4 °C for 10 min. Supernatants were collected and supplemented with internal control (800 ng myristic acid-D27) and dried in a cold vacuum centrifuge (Labconco) overnight. The dried pellets were reconstituted with 30 μL of 10 mg/mL methoxyamine-HCl in pyridine, incubated for 30 min at room temperature. Samples were then derivatized with MTBSTFA for 30 min at 70 °C. A volume of 1 μL of sample was injected splitless with an inlet temperature of 280°C into the GC/MS instrument (5975 C, Agilent). Metabolites were resolved by separation on DB-5MS + DG (30 m x 250 µm x 0.25 µm) capillary column (Agilent J&W, Santa Clara, CA, USA). Helium was used as the carrier gas with a flow rate such that myristic-d27 acid eluted at approximately 18 min. The quadrupole was set at 150˚C, the source was at 230 °C and the GC/MS interface at 320˚C. The oven program started at 60˚C held for 1 min, then increased at a rate of 10˚C/min until 320˚C. Bake-out was at 320˚C for 9 min. Metabolites were ionized by electron impact at 70 eV. All samples were injected three times: twice using scan (50–1000 m/z) mode (1x and 25x dilution for steady state samples or 1x and 24x dilution for tracer samples) and once using selected ion monitoring (SIM) mode. All of the metabolites described in this study were validated against authentic standards confirming mass spectra and retention times. Integration of ion intensities was accomplished using Mass Hunter Quant (Agilent). Generally, M-57+. Ions (and isotopes) were analyzed. Mass isotopomer distribution analysis was carried out using in-house software using an in-house algorithm adapted from Nanchen et al. as previously described73.
Immunohistochemistry
Tissue microarrays (TMAs) of patient tumors from McGill (52 SCCOHT cases)26 and UBC (24 SCCOHT and 108 epithelial ovarian carcinoma cases)34 were as previously described. Studies on SCCOHT patient tumors were approved by the Institutional Review Board (IRB) at McGill University, McGill IRB # A08-M61-09B, and UBC, IRB# H18-01652. Informed consent was obtained from all participants in accordance with the relevant IRB approvals. For all IHC analysis, cores with low tumor cellularity and artifacts were not included in the analysis.
SCCOHT and other ovarian cancer TMAs were cut at 4 μm thickness onto Superfrost Plus glass slides, and were processed using the Leica BOND RX Stainer. Immunohistochemical (IHC) staining was performed with antibodies to GLUT1 (1:3000, ab115730, Abcam), SMARCA4 (1:2000, ab110641, Abcam), SMARCA2 (1:200, HPA029981, Sigma) and Cyclin D1 (1:400, #2978, Cell Signaling Technology). GLUT1 expression was reviewed by a pathologist (D.G.H) and quantitated using the Aperio ImageScope software. The GLUT1 positivity was defined by the counts of pixels above the threshold to all pixel counts in the tumor area analyzed.
Survival analysis
Survival analyzes of lung adenocarcinoma patients (n = 1003) were performed using data derived from cBioportal (https://www.cbioportal.org/). This dataset was analyzed by first separating patients into two groups (SMARCA4 deletion, SMARCA4 normal) according to SMARCA4 copy number status. Next, patients in each group were stratified into SLC38A2 high (top 50%) and low groups (bottom 50%), followed by log-rank test. Patients with and without SMARCA4 alterations were analyzed separately.
Mouse xenografts and in vivo drug efficacy studies
Animal experiments were performed according to standards outlined in the Canadian Council on Animal Care Standards (CCAC) and the Animals for Research Act, R.S.O. 1990, Chapter c. A.22, and by following internationally recognized guidelines on animal welfare. All animal procedures (Animal Use Protocol #7407 (McGill) and # A17-0146 (UBC)) were approved by the Institutional Animal Care Committee according to guidelines of the CCAC. Since all human cell line-derived xenografts and PDXs were derived from female patients, all animal experiments in this study used female mice. Housing conditions: Temperature: 16 degrees min − 24 degrees max; Humidity: 15% low – 60% high; Photoperiod: 7am–7pm light, 7pm–7am dark (McGill); 6a–6pm light, 6pm–6am dark (UBC). The animal experiments carried out at Goodman Cancer Research Institute of McGill University used 8–12-week-old in-house bred female NOD.Cg-Prkdcscid Il2rgtm1Wjl/SzJ (NSG) mice; the animal experiments carried out at British Columbia Cancer Research Institute used 7–9 week-old in house bred female NRG (NOD.Rag1KO.IL2RγcKO) mice. To establish xenograft models, COV434 cells (2×106 cells/mouse) or SCCOHT PDX465 (34, 50 mg/mouse, homogenized and resuspended in HBSS) were injected with a 1:1 mix of matrigel (Corning) in a final volume of 200 μl subcutaneously into the back of NRG mice; BIN-67 cells (10×106 cells/mouse) with a 1:1 mix of matrigel (Corning) in a final volume of 100 μl subcutaneously into the right flank of NSG mice; and SCCOHT PDX NRTO-1 and NRTO-5, established and viably preserved at Goodman Cancer Research Institute of McGill University, and Lung PDX obtained from The Jackson Laboratory (TM01563), were cut into pieces and then inserted into a pocket in the subcutaneous space of NSG mice. Mice were randomized to treatment arms once the average tumor volume reached 100 mm3. IACS-010759 was resuspended in 0.5% methylcellulose administrated by gavage at 7.5 mg/kg (6-on 1-off for SCCOHT PDX#2; 5-on 2-off for the remaining PDXs). CB839 was resuspended in 25% (w/v) HPBCD in 10 mM citrate (pH2) administrated by gavage at 200 mg/kg twice daily. Alanine was resuspended in 0.9% sodium chloride solution administrated by gavage at 4 g/kg daily (3 times a day, each time 250 ul). Cisplatin (SelleckChem) was resuspended in 0.9% sodium chloride solution administrated intraperitoneally at 2 mg /kg once a week (3 weeks on 1 week off). Tumor volume and mouse weight were measured twice to thrice weekly. Tumor volume was calculated as length*(width)2*0.52. The persons who performed all the tumor measurements were blinded to the treatment information. Experiments involving COV434 xenograft and SCCOHT PDX#2 were carried out at BCCRI. Experiments involving BIN-67 xenograft, SCCOHT PDX#1 and #3 and lung PDX#1 experiments were carried out at the Goodman Cancer Research Institute of McGill University. The maximal tumor size permitted by our Institutional Animal Care Committees is 2500 mm3, which was not exceeded in our experiments.
Statistics and reproducibility
GraphPad Prism 8 software was used to generate graphs and statistical analyzes. Statistical significance was determined by one- and two-way ANOVA, Student’s t-test, log-rank test. Methods for statistical tests, the exact value of n, and definition of error bars were indicated in figure legends, *p < 0.05, **p < 0.01, ***p < 0.001, and ****p < 0.0001. For simplicity, one-way ANOVA Brown–Forsythe and Welch tests followed by Dunnett’s test for multiple comparisons is referred as “one-way ANOVA corrected for multiple comparisons” in the figure legends. All experiments have been reproduced in at least two independent experiments unless otherwise specified in the figure legends. All immunoblots and images shown are representatives of these independent experiments.
Reporting summary
Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.