Friday, February 23, 2024
BestWooCommerceThemeBuilttoBoostSales-728x90

Artesunate treats obesity in male mice and non-human primates through GDF15/GFRAL signalling axis – Nature Communications


Mouse

C57BL/6 J male wild-type (WT) mice and Sprague-Dawley rats were provided by The Chinese University of Hong Kong. Gfral/ were purchased from Cyagen Biosciences Inc and housed at the Hong Kong Baptist University. Gfral/ and their WT littermate controls were generated on C57BL/6 background as described previously48. All mice and rats were housed in a temperature-controlled room with 12-h light/12-h dark cycle with ad libitum access to food and water. Only male mice and rats were used in the experiments. All experimental protocols involving mice and rats were reviewed and approved by the Use of Human & Animal Subjects in Teaching & Research (HASC) at Hong Kong Baptist University and in compliance with the Department of Health, Hong Kong.

High-fat-diet feeding

One week after weaning, mice were randomly selected and assigned to one of two dietary treatments: control diet (Research diets #D12450J) or HFD (Research diets #D12492). On a caloric basis, the control diet is with 10 kcal% fat whereas HFD is with 60 kcal% fat.

Drug treatment

For ART treatment, mice received 5 mg/kg or 20 mg/kg of ART (MB7317, Meilunbio) or vector (5% sodium bicarbonate mixed with 0.9% physiological saline) intraperitoneally (i.p.) according to the different experimental requirements until the end of the experiment, and the inoculation period is indicated in the different mouse experiments and in each figure legend.

For metformin-treated mice, Metformin hydrochloride (M107827, Aladdin) was dissolved in ddH2O, and intragastric administration (i.g.) with Metformin hydrochloride at a concentration of 200 mg/kg according to the body weight of the mice.

For liraglutide treatment, liraglutide (L276430, Aladdin) was dissolved in 0.9% saline, and mice were injected subcutaneously (s.c.) at a concentration of 100 ug/kg of liraglutide according to body weight.

Animal protocol 1: effect of ART on wild-type mice in HFD challenge

C57BL/6 J mice at the age of 8 weeks were randomly assigned for the experiment. During HFD challenge, mice were treated with intraperitoneal injections of vehicle control and ART every two days (vehicle, ART low-dose treatment group 5 mg/kg, ART high-dose treatment group 20 mg/kg, 8 mice in each group). The body weight and food intake of the mice were monitored daily. At the indicated time points, mice were anaesthetised in an isoflurane-saturated chamber after 6 h of starvation and then sacrificed by cardiac puncture.

Animal protocol 2: effect of ART on mice with diet-induced obesity

C57BL/6 J mice were fed HFD for 16 weeks until their mean body weight was 43.35 g ± 1 g. Mice were then randomly assigned to the experiment (vehicle, ART treatment group, 6 mice per group). Body weight and food intake were monitored daily. At the indicated time points, mice were anaesthetized in an isoflurane-saturated chamber after 6 h of starvation and then sacrificed by cardiac puncture.

Animal protocol 3: pair feeding

Pair-fed vehicle-treated animals received the amount of food equivalent to that of the corresponding ART-treated group. Body weight and food intake were measured daily.

Animal protocol 4: lean mice treated with ART

C57BL/6 J mice (lean, weighing 23 to 25 g) were injected intraperitoneally with the vehicle or ART for 2 weeks. Body weight and food intake were monitored daily.

Animal protocol 5: effect of ART in GDF15 knockdown mice

C57BL/6 J mice were fed with high-fat diet for 16 weeks until their mean body weight was 45.59 g ± 0.64 g. AAV8-shControl and AAV8-shGDF15 virus produced by the pAAV-U6-shRNA (Gdf15)-CBh-EGFP-WPRE vector plasmid were purchased from Obio Technology Ltd. This vector plasmid was an AAV vector of serotype 8 under the control of U6 promoter, a well-documented AAV vector for specific transgene expression in hepatocytes. They were delivered by tail vein injection (1 × 1011 copies per mouse). Mice were studied 2 weeks after AAV8 infection. Mice were then randomly assigned to the experiment (vehicle, ART treatment group, 6 mice per group) groups and injected accordingly with vehicle or ART every two days for 3 weeks. Mice were monitored daily for body weight and food intake. Mice were anaesthetized in an isoflurane-saturated chamber and then sacrificed by cardiac puncture for tissue harvest.

Animal protocol 5: effect of ART on Gfral
−/− mice

Experimental cohorts of Gfral/ and Gfral+/+ mice were obtained from het x het breeding pairs48. Gfral+/+ and Gfral/ mice at 12 weeks of age were treated with HFD for 4 weeks, and each mouse was intraperitoneally injected with vehicle or ART every two days for 3 weeks, and their body weight and food intake were monitored daily. On day 21, mice were euthanized by terminal anaesthesia 6 h after treatment, and plasma was obtained. Tissues were freshly frozen on dry ice and stored at −80 °C.

Animal protocol 6: cynomolgus monkey efficacy study

For the non-human primate model of obesity, eight male macaques with a mean age of 12.5 years, MI > 40 and body condition scoring >4.549were selected for training, which focused on simulated blood collection for a 2-week training period, after which five macaques were selected for formal experiments based on the training performance and basic biochemical data. Only male macaques were used for the experiments. Macaques were treated with intravenous injections of vehicle every two days through 2 weeks. After a 2-week washout period, macaques were treated with ART (6.4 mg/kg) every two days intravenously for 2 weeks. Food intake was counted daily, and animal body weight was measured every 3 days. These macaques were housed individually in stainless steel cages and maintained at ambient temperature (16–26 °C) and humidity (~60%) under a 12-h (h) light/dark cycle. Breakfast (80 g) and dinner (120 g) were the standard maintenance diet for non-human primates (Jiangsu Synergy Pharmaceutical and Biological Engineering Co., Ltd.), and lunch was apple (70 g). Animals were fed water ad libitum through a waterer. All husbandry conditions and procedures were approved by Guangzhou Huazhen Bioscience Co., Ltd (IACUC) and conformed to the ethical guidelines of their Institutional Animal Care and Use Committee. The husbandry facilities were accredited by the American Association for Assessment and Accreditation of Laboratory Animal Care (AAALAC).

Animal protocol 7: effect of ART on kaolin consumption in HFD-induced obese rats

The kaolin intake experiment is a well-recognised model for assessing pica behaviours in Sprague-Dawley rats50. 8-week-old male rats were fed with HFD to a body weight of 560 g–610 g. One week prior to the start of treatment, kaolin was added to allow the animals to acclimatize. The rats were then divided into 3 weight-matched groups (5 rats per group) and injected intraperitoneally daily with vehicle, ART (14 mg/kg). Food, kaolin intake, and body weight were measured daily.

Animal protocol 8: comparison of ART with liraglutide and metformin for the treatment of obese mice

Eight-week-old male mice were treated with HFD for 8 weeks to a mean body weight of 44.5 g (±2.1), after which the mice were equally assigned by body weight to Vehicle (44.4 ± 0.7 g), LTR (44.4 ± 1.2 g), MEF (44.4 ± 0.8 g), and ART (44.6 ± 0.7 g) group. DIO mice were treated with Vehicle, LTR, MEF, and ART every two days, and body weight and food intake were measured daily, followed by GTT and ITT assays on DIO mice. Mouse serum was collected for biochemical analysis. Thereafter, mice were anaesthetized in an isoflurane-saturated chamber and then sacrificed by cardiac puncture for tissue harvest.

Animal protocol 9: effect of ART on gastrointestinal parameters

C57BL/6 J mice were treated with vehicle or ART for 8 weeks and monitored daily for body weight. To measure the gastrointestinal transit time, individually caged mice were orally gavaged with 150 µl of Carmine red solution prepared as 6% (w/v) solution in 0.5% methylcellulose. Time taken to release the first carmine red faecal pellet after the initial gavage was recorded as total intestinal transit time. Faecal pellet output was calculated by counting the number of pellets released from each mouse in an observation period of 1 h. Collected faecal pellets were dried overnight in an oven and measured for the dry weight. Percentage difference between the initial faecal wet weight and dry weight indicated faecal water content.

Glucose tolerance test and Insulin tolerance test

To perform GTT, mice were fasted overnight and received IP injection of 20% glucose (2 g kg-1 of body weight, Sigma–Aldrich). For ITT, mice fasted for 6 h received IP injections of insulin (0.5 units kg-1 body weight, Sigma–Aldrich). Tail glucose levels were measured at the indicated times (0, 30, 60, 90 and 120 min) after injection.

Antibodies

The antibodies used in this study include the following: anti-GFRAL antibody (ab214929, Abcam, 1:100 dilution for immunofluorescent staining); anti-FOS (FOS, 2250, Cell Signaling Technology, 1:200 dilution immunofluorescent staining); anti-GDF15 (27455-1-AP, Proteintech, 1:2,000 dilution for western blot); anti-CHOP (15204-1-AP, Proteintech, 1:2,000 dilution for western blot); anti-β-actin (sc-47778, Santa Cruz, 1:2,000 dilution for western blot); m-IgGκ BP-HRP (sc-516102, Santa Cruz, 1:5,000 dilution); goat anti-rabbit antibody conjugated with HRP (sc-2357, Santa Cruz, 1:5,000 dilution); Alexa Fluor 488-conjugated donkey anti-sheep antibody (A-11015, Invitrogen, 1:500 dilution); Alexa Fluor 594-conjugated goat anti-rabbit (A11012, Invitrogen, 1:500 dilution).

Biochemical analysis

GDF15 levels in mouse plasma were measured by enzyme-linked immunosorbent assay (ELISA, R&D Systems, MGD150). GDF15 in macaque plasma was measured by enzyme-linked immunosorbent assay (ELISA, Cloud-clone, SEC034Si). Plasma insulin was assessed after 12 h of fasting using the Cloud-clone Rat/Mouse Insulin ELISA Kit (CEA448Mu) according to the manufacturer’s instructions.

Cell treatment

Hep-G2 cells were purchased from ATCC (HB-8065). MIHA cell line was a gift from the University of Hong Kong, which was originally purchased from the National Collection of Authenticated Cell Cultures (https://www.cellbank.org.cn/); the sex origins of cell lines are unknown. MEF cells were isolated using 13.5 days developed embryos, digested into single-cell suspensions using 0.25% trypsin-EDTA and cultured for 2 generations for experiments. Hep-G2, MIHA and MEF cells were cultured in DMEM (Gibco) supplemented with 10% FBS and penicillin/streptomycin (100 ng/ml). Cells used in the experiments were tested free of mycoplasma contamination. All cell lines were passaged for no more than 10 generations. For siRNA transfection, 80–90% confluent cells were transfected using Lipofectamine RNAiMAX (Invitrogen). Two technical replicates and three biological replicates were used for each cell experiment.

Western blotting

Western blot was performed as previously described:51 total protein was extracted from cell or tissue samples using RIPA buffer composed of 25 mM Tris-HCl, 150 mM NaCl, 1% NP-40, 0.1% SDS, 1% sodium deoxycholate and complete protease cocktail (Roche) on ice. Samples were sonicated four times for 5 s on ice water at 15% power (Ningbo Scientific Biotechnology). Tissue lysates were centrifuged at 4 °C for 10 min at 14,000 g and supernatant was mixed with 4× LDS Sample Buffer (NP0007) and boiled for 10 min at 70 °C. The 10-μg protein samples were separated by 4–12% SDS–PAGE with MOPS-SDS running buffer and transferred to polyvinylidene difluoride membranes (Bio-Rad Laboratories). Membranes were blocked with 5 QuickBlock™ Western Blocking Solution (P0252, Beyotime Biotechnology) for 1 h and then incubated with primary antibodies prepared using Western Primary Antibody Diluent (P0256, Beyotime Biotechnology) at 4 °C overnight. Membranes were incubated with HRP-conjugated secondary antibodies prepared using QuickBlock™ Western Secondary Antibody Diluent (P0258, Beyotime Biotechnology), and incubated for 1 h at room temperature. Immunoreactions were captured by X-ray films detecting chemiluminescence using an ECL kit (GE Healthcare). The full scan blots can be found in the Fig. S16.

Biochemical analysis of serum samples

Whole blood specimens are placed at room temperature for 2 h and then centrifuged at 24 °C for 15 min at 3000 rpm, and the supernatant is taken for immediate detection, or the specimens are divided and stored at −80 °C. ALT, AST, TG, TC, HDL, and LDL are measured according to the kit manufacturer’s instructions (Shenzhen Rayto Life Sciences) and are automatically determined using a fully automated biochemistry instrument (Shenzhen Rayto Life Sciences, Chemray 800).

Real-time qPCR

Total RNA was extracted from cells or tissues using the RNAeasy™ Animal RNA Isolation Kit with Spin Column Reagent (Beyotime) according to the manufacturer’s protocol. A total of 500 ng RNA was reverse-transcribed using PrimeScript RT master mix (Takara Bio). The resulting cDNA templates amplified with specific primers of target genes were analysed by the ABI ViiA 7 Real-time PCR System (Applied Biosystems) using real-time PCR kits (Takara Bio). The sequences of primers used include Gdf15: AGCCGAGAGGACTCGAACTCAG (forward); GGTTGACGCGGAGTAGCAGCT (reverse); Gapdh: GAGCCAAAAGGGTCATC (forward); GTGGTCATGAGTCCTTC (reverse); GDF15: CAACCAGAGCTGGGAAGATTCG (forward); CCCGAGAGATACGCAGGTGCA (reverse); CHOP: GGTATGAGGACCTGCAAGAGGT (forward); CTTGTGACCTCTGCTGGTTCTG (reverse); beta-actin: CACCATTGGCAATGAGCGGTTC (forward); AGGTCTTTGCGGATGTCCACGT (reverse).

Hematoxylin and Eosin (H&E) staining

Freshly extracted tissues were fixed overnight in 4% PFA and subsequently dehydrated with gradient alcohol using a gradient dehydrator (LTP-200, HASCO), followed by wax immersion of the samples. The wax-impregnated tissues were embedded in an embedding machine (ES-500, Huaspeed Technology), and the trimmed wax blocks were subsequently sectioned on a paraffin microtome. For HE staining, paraffin sections were dewaxed to water and subsequently stained with hematoxylin for nuclei and eosin for cytoplasm, and images were acquired and analysed using a scanner (3D histech, Pannoramic MIDI).

Oil Red O staining

The collected fresh tissues were frozen sectioned using OCT embedding and subsequently stained using Oil Red O Staining Kit (C0157S, Beyotime). Specifically, an appropriate amount of staining washing solution was added to cover the samples for 20 s, followed by aspiration of the staining washing solution. The prepared Oil Red O staining working solution was added dropwise to the sections for staining for 10–20 min, removal of Oil Red O staining working solution was added dropwise to the sections and left for 30 s, then the staining washing solution was removed, and the sections were immersed in distilled water and washed on a shaker for 20 s, and the nuclei were re-stained using hematoxylin staining solution (C0107), sealed and then observed and photographed under the microscope.

Immunohistochemistry

For all immunohistochemistry experiments, mice were anaesthetized using isoflurane and perfused with ice-cold saline (0.9%) followed by 4% paraformaldehyde (PFA) in 0.1 M PBS. Brains were post-fixed overnight in 4% PFA and preserved with 30% sucrose (w/v) at 4 °C for 48 h. 10 μm serial coronal sections were prepared using Cryostat (Leica Biosystems). Coronal sections within the distance of −7.48 to −7.64 mm from bregma were checked for area postrema region by observing through the microscope for the anatomical landmarks as described in the mouse brain atlas52. Sections were permeabilized with 0.1% Triton-X 100 in 0.1 m PBS for 15 min and blocked with 1% BSA in PBST for 1 h. Sections were incubated overnight with primary antibodies at 4 °C, followed by secondary antibodies at room temperature for 1 h. Slides were mounted using Prolong Gold with or without DAPI (Thermo Fisher). Images were obtained using a Confocal Laser Scanning Microscope (Leica TCS SP8). Gfral+ cFos+ cells were counted in every third serial section and at least 5 sections were quantified to span the entire AP region.

Energy expenditure

Mice were profiled for energy expenditure (EE) in Promethion metabolic cages (Sable Systems International, Las Vegas, NV). Mice were singly housed in Promethion cage equipped with a food hopper, and water spigot connected to a load cell for continuous real-time monitoring of food (g) and water intake (g). Mice were acclimatised for one week before the experiment start-date to minimise the stress of the new environment. After the acclimatisation, body composition and weight were recorded for the baseline values. X/Y/Z beam-break systems were positioned around the cage to detect the mouse activity and to facilitate the quantitative measurement of physical activity. Cages were connected to an oxygen sensor and carbon dioxide sensor to examine the rate of oxygen consumption (VO2) and rate of carbon dioxide emission (VCO2) in ml/min. Respiratory exchange ratio (RER) was calculated as the ratio of CO2 production to O2 consumption. Energy expenditure (EE) (per kg body weight) was calculated using the Weir equation53. Analysis of covariance (ANCOVA) was performed with body weight as a covariate for EE measurements. All the raw data were processed using a macro interpreter provided by Sable Systems and data acquisition was coordinated by MetaScreen software (v.2.3.15.12).

Neurobehavior assessment

Morris water maze was performed as described previously54. Mice were examined for six days (2trials/day) to navigate and locate the hidden platform present in a circular pool filled with opaque water. Visualisation cues were positioned around the water maze and starting position was selected randomly every day. Mouse movement were tracked automatically using the Any-Maze video tracking recording system. Each mouse was analysed for escape latency (time taken to locate the hidden platform), path length (distance travelled to reach the hidden platform) and average swimming speed.

Statistical analyses

Data was expressed as means ± standard error (mean ± SEM) and the statistical significance was set at p < 0.05. The statistical analyses were performed with GraphPad Prism 8.0 (GraphPad Software, LLC, San Diego, CA) and tested by either Student’s t-test, one-way or two-way ANOVA as indicated in the figure legends. The sample size and number of replicates for each experiment are described in the figure legends. In vivo experiment involving a minimum of three independent age-matched mice and randomisation were performed where applicable. The sample size was estimated with the power of the statistical test performed.

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.



Source link

Related Articles

Leave a Reply

[td_block_social_counter facebook="beingmedicos1" twitter="being_medicos" youtube="beingmedicosgroup" style="style8 td-social-boxed td-social-font-icons" tdc_css="eyJhbGwiOnsibWFyZ2luLWJvdHRvbSI6IjM4IiwiZGlzcGxheSI6IiJ9LCJwb3J0cmFpdCI6eyJtYXJnaW4tYm90dG9tIjoiMzAiLCJkaXNwbGF5IjoiIn0sInBvcnRyYWl0X21heF93aWR0aCI6MTAxOCwicG9ydHJhaXRfbWluX3dpZHRoIjo3Njh9" custom_title="Stay Connected" block_template_id="td_block_template_8" f_header_font_family="712" f_header_font_transform="uppercase" f_header_font_weight="500" f_header_font_size="17" border_color="#dd3333"]
- Advertisement -spot_img

Latest Articles