Research compliances
All analyses of human materials were done in full agreement with our institutional guidelines, with the approval of the Ethical committee of the Xijing Hospital, the Fourth Military Medical University (KY20203171-1). Written informed consent was obtained from each participant. This study is compliant with the “Guidance of the Ministry of Science and Technology (MOST) for the Review and Approval of Human Genetic Resources.” All animal procedures complied with the National Institutes of Health Guide for the Care and Use of Laboratory Animals and with Institutional Animal Care and Use Committee approval at the Fourth Military Medical University. Animal Experimental Ethical Inspection was approved Laboratory Animal Welfare and Ethics Committee of Fourth Military Medical University.
Patient Selection
Patients enrolled in our study fulfilled the diagnostic criteria for psoriasis and disease activity was scored by the PSAI. Patients were randomly recruited from outpatient, inpatient and were eligible to participate if they: were ≥18 years of age; reported regular work schedules and sleep-wake patterns in the preceding 4 weeks; without other autoimmune or systemic diseases and were not receiving systemic treatment in the recent 4 weeks. Controls were collected from sex-, and age-matched healthy volunteers. The patients were recruited according to the objective criteria of age, gender, and health status and no self-selection bias affected the recruitment. Demographic information of patients is provided in Supplementary Table 1.
Experimental Animals
C57BL/6 J mice (8–10 weeks old) were purchased from Department of Laboratory Animal Medicine of the Fourth Military Medical University (Xian, Shaanxi, China; permit number: 2019-001). Both male and female were used for all experiments. Mice were randomly assigned to groups of 6 mice, then bred and maintained in a specific pathogen-free barrier facility. For in vivo experiments, researchers were blinded to the treatment of each animal received until data were analyzed. After the experiments, mice were euthanized by an overdose of sodium pentobarbital.
For psoriasis-like mouse model, mice received daily topical applications of 62.5 mg IMQ cream (5% IMQ, INova Pharmaceuticals, 3 M Health Care) on the shaved dorsal skin for consecutive 5 days. Neutrophil depletion was done using intraperitoneally injection of purified anti-Ly6G antibody (127649, Biolegend, USA) vs. isotype control antibody (400565, Biolegend) every other day. The dose of the first injection was 100 μg, and the subsequent injection dose was 50 μg. IMQ mice were subcutaneously injected with purified Ly6G+CXCR4lo or Ly6G+CXCR4hi neutrophils (6×105/mouse) isolated from peripheral blood of homologous mice. Schematic diagram of experimental protocol is shown in Fig. 7d. Peripheral blood of C57BL/6 wild-type mice was collected, and mouse neutrophils were isolated using a magnetic-activated cell sorting method by mouse Ly6G MicroBeads (130-120-337, Miltenyi Biotec Inc., USA). CXCR4hi neutrophils were also obtained by positive selection from total neutrophils using mouse CXCR4 MicroBeads (130-118-682, Miltenyi Biotec Inc.) according to the manufacturer’s protocol, as depicted below.
In our in vivo experiment, 10 mg/kg of AMD3100 hydrate (A5602, Sigma-Aldrich, USA), a selective CXCR4 antagonist was administered intraperitoneally every day to inhibit CXCR4 function. AMD3100 was dissolved in PBS (PC-00003, PlantChemMed, Shanghai, China) and PBS served as vehicle control. To neutralize CXCL12, IMQ mice were administered intraperitoneally with anti-mouse CXCL12 monoclonal antibody (1 mg/kg, MAB310, R&D Systems, USA) or control mouse IgG (1 mg/kg, MAB002, R&D Systems) every other day. Moreover, a bolus injection of AMD3100 (0.1, 1, or 10 mg/kg) and CXCL12 monoclonal antibody (0.1, 0.5, or 1 mg/kg) was administered intraperitoneally at various concentrations to explore the optimal inhibitory concentration (Supplementary Fig. 13, 14).
To investigate cutaneous vascular permeability, Evans blue dye (50 mg/kg, E8010, Solarbio technology, Beijing, China) was injected by tail vein. 2 h later, the shaved back was resected (10 mm in diameter) and incubated in 1 ml formamide (V900064, Sigma-Aldrich) at 56 °C for 48 h to extract the dye. Absorbance of extravasated Evans blue dye was measured at 610 nm wavelength and the relative absorbance of extravasated dye was normalized to that of PBS.
Blood sampling handling and neutrophil isolation
To eliminate the influence of circadian rhythm, all blood samples in this study were collected at 7:00 – 8:00 am and immediately processed for cell isolation and serum collection. Then isolated neutrophils were processed immediately for the next experimental steps and serum was frozen at -80 °C. Moreover, all selected participants in this study reported both regular work schedules and sleep-wake patterns in the preceding 4 weeks. As neutrophil stimulation assays were performed at different times of the day, the data regarding percentages of CXCR4hi neutrophils or CXCR4 expression were normalized by calculating the ratio between the values of samples containing stimulus and the values of samples with corresponding controls in each test.
4 ml blood was layered on top of 4 ml of Polymorphprep (1114683, Axis-Shield, Norway) in a 15 mL centrifugation tube. The tube was centrifuged at 500 g at 20 °C for 30 min. The polymorphonuclear cell layer was collected and red blood cells were removed using Red Blood Lysing Buffer (FXP001, 4 A Biotech Co., Ltd, Beijing, China). Freshly isolated neutrophils were suspended at 1×107/ml in PBS. For separation of CXCR4hi neutrophils, cells labeled with MACS beads are captured by the magnetic field of the separator (Miltenyi Biotec Inc., 130-090-312), whereas unlabeled cells pass the magnetic field and end up in the flow-through fraction. In short, freshly isolated neutrophils were re-suspended in 100 µL MACS Separation Buffer (130-091-221, Miltenyi Biotec Inc.) and stained with APC-conjugated anti-human CXCR4 antibody (2 µL/107 cells) for 10 min, cells were washed and then incubated with anti-APC microbeads (20 µL/107 cells, Miltenyi Biotec Inc., 130-100-070) in 80 µL MACS Separation Buffer (130-091-221, Miltenyi Biotec Inc.) for 15 min in the dark. Subsequently, the CXCR4hi neutrophils were separated on an MS column (130-042-201, Miltenyi Biotec Inc.) on a MACS Separator (130-090-312, Miltenyi Biotec Inc.) and washed again to detach from the antibody-magnetic bead. Isolation efficiencies were analyzed by incubating cells with FITC conjugated anti-human CD15 (301904, 1:100, BioLegend) and PE-Cy7 conjugated anti-human CXCR4 (306514, 1:100, BioLegend), for 30 min at 4 °C (Supplementary Fig. 17a).
Mouse neutrophils were isolated from the peripheral blood of healthy 8-week-old C57Bl6/J mice. Mice were anesthetized via intraperitoneal injection of 1% sodium pentobarbital (4579, 100-150 μL/mouse, R&D Systems), and the eyeball was removed to collect blood samples. Peripheral blood was taken from 10 mice each time to achieve neutrophil counts and erythrocytes were removed using Red Blood Lysing Buffer (FXP001, 4 A Biotech Co., Ltd). Up to 108 cells were resuspended in 200 μL of MACS buffer (130-091-221, Miltenyi Biotec Inc.) and incubated with 50 µL of anti-Ly6G biotin beads per sample (130-120-337, Miltenyi Biotec Inc.) for 15 min in the dark at 4 °C. The cells were then washed and centrifuged, resuspended in MACS buffer, and passed through a LS column (130-042-401, Miltenyi Biotec Inc.) on a MACS Separator (130-042-303, Miltenyi Biotec Inc.). The magnetically labeled Ly6G+ cells were retained on the column. The labeled cells were collected, washed once with MACS buffer, and centrifuged at 300 g for 10 min. The isolated neutrophils were resuspended in PBS for subsequent experiments.
To separate mouse CXCR4hi and CXCR4lo neutrophils, freshly isolated neutrophils were re-suspended in 100 µL MACS Separation Buffer (130-091-221, Miltenyi Biotec Inc.) and stained with PE-conjugated anti-mouse CXCR4 antibody (2 µL/107 cells, 130-118-682, Miltenyi Biotec Inc.) for 10 min, cells were washed and then incubated with anti-PE microbeads (20 µL/107 cells, 130-048-801, Miltenyi Biotec Inc.) in 80 µL MACS Separation Buffer (130-091-221, Miltenyi Biotec Inc.) for 15 min in the dark. Then, mouse CXCR4hi neutrophils were separated on LS column (130-042-401, Miltenyi Biotec Inc.) on a MACS Separator (130-042-303, Miltenyi Biotec Inc.) and washed again. Isolation efficiencies were analyzed by incubating cells with FITC anti-mouse Ly6G (127606, 1:100, BioLegend) and PE anti-mouse CXCR4 (146506, 1:100, BioLegend) for 30 min at 4 °C. The purity of the cells was routinely 90 to 95%, (Supplementary Fig. 17b).
Flow cytometry analysis
For the analysis of neutrophils phenotypes, total blood leukocytes from healthy controls and psoriasis patients were washed and incubated with the following primary antibodies: FITC conjugated anti-human CD15 (301904, 1:100), PE-Cy7 conjugated anti-human CD15 (301924, 1:100), PE conjugated anti-human CXCR4 (306506, 1:100), PE-Cy7 conjugated anti-human CXCR4 (306514, 1:100), PE-Cy5 conjugated anti-human CD62L (304808,1:100), PE conjugated anti-human CD11b (393112, 1:100), Pacific/Blue conjugated anti-human CD11b (301315, 1:100), PE anti-human CD44 (338808, 1:100), PerCP/Cy5.5 conjugated anti-human CD101 (331016, 1:100), PE-Cy5 anti-human CD10 (312206, 1:100), APC/Cy7 conjugated anti-human CD10 (312212,1:100) (all from BioLegend) for 30 min at 4 °C. For intracellular staining, neutrophils were isolated and stained with FITC anti-human CD15 (301904, 1:100, BioLegend) and PE-Cy7 anti-human CXCR4 (306514, 1:100, BioLegend) for 30 min at 4 °C in the dark; after washing with PBS, cells were incubated with fixation/permeabilization buffer (562574, BD Pharmingen) at 4 °C for 50 min and then incubated with Rabbit monoclonal to phospho-CREB1 (9198 S, 1:800, Cell Signaling Technology (CST), USA), Rabbit monoclonal to HK2 (209847, 1:60, Abcam, USA), Rabbit monoclonal to GLUT1 (115730,1:40, Abcam), and PE-anti-human HIF1A (359704, 1:100, BioLegend). After centrifuging at 350 g for 5 min, cells were incubated with PE Donkey anti-Rabbit IgG (406421, 1:100, BioLegend) for 30 min at 4 °C in dark. After washing with PBS, the cells were analyzed by flow cytometry (649225, BD LSRFortessa Cell Analyzer), and data were analyzed with Flowjo v10.8.1 (Tree Star). We used the fluorescence minus one (FMO) as a negative control, which contains all the fluorochromes except for the one that is being measured.
Imaging Flow Cytometry
CXCR4hi and CXCR4lo neutrophils isolated from healthy controls and psoriasis patients were stained with FITC anti-human CD15 (301904, 1:100, BioLegend) and PE-Cy7 anti-human CXCR4 (306514, 1:100, BioLegend) for 30 min at 4 °C in the dark. After washing, cells were fixed and permeabilized with a fixation/permeabilization kit (562574, BD Pharmingen, USA) according to the manufacturer’s instructions and incubated with the antibodies, PE conjugated anti-human CD63 (353004, 1:100, BioLegend), Rabbit monoclonal to Lipocalin-2 (125075, 1:400, Abcam), and Rabbit monoclonal to MMP9 (76003, 1:500, Abcam) for 40 min at 4 °C in the dark. Samples were then washed with PBS and incubated with secondary antibodies conjugated with APC anti-Mouse IgG Antibody (406610, 1:100, Biolegend) or Brilliant Violet 421 Donkey anti-Rabbit IgG (minimal x-reactivity) Antibody (406410, 1:100, Biolegend) for 40 min at 4 °C in the dark. The cells were analyzed using an imaging flow cytometer (ImageStream Mark II, Luminex) at a magnification of 40X. The IDEAS 6.2 software (Amnis) was used to visualize and analyze samples for marker expression. Single stained control cells were used to compensate for fluorescence between channel images, to prevent overlap of emission spectra. Cells were gated for single cells based on the area and aspect ratio features, and for focused cells using the Gradient RMS feature. Finally, cells were gated for positive staining based on their pixel intensity.
Phagocytosis
To assess the phagocytic capacity, neutrophils from healthy controls and psoriasis patients were isolated and incubated with pHrodo Green E coli (2 mg/mL; P35366, Thermo Fisher Scientific, USA) at 37 °C for 30 min. Incubation was stopped by the addition of 2 mL of PBS, and cells were then washed 3 times. Cells were divided into two parts, the first of which was used for flow staining. After incubated with PE-Cy7 conjugated anti-human CD15 (301924, 1:100, BioLegend) and PE conjugated anti-human CXCR4 (306506, 1:100, BioLegend) at 4 °C for 30 min. Phagocytic uptake was analyzed by flow cytometry and expressed as median fluorescence intensity (MFI). The remaining cells, which were not used for flow staining, were incubated with Hoechst 33258 (C0021, 1:1000, Solarbio technology) for 15 min for following confocal microscope (LSM880, Carl Zeiss, Germany).
Glycolytic activity analysis
Supernatants of CXCR4lo and CXCR4hi neutrophils were collected after 6-hour cell culture, and lactate was assessed via a lactate assay kit (A019-2-1, Nanjing Jiancheng Bioengineering Institute, Nanjing, China) according to the manufacturer’s instructions. For glucose uptake detection, isolated neutrophils were incubated with 100 mM 2-NBDG (N13195, Invitrogen) for 2 h and then stained with PE-Cy7 conjugated anti-human CD15 (301924, 1:100, BioLegend) and PE conjugated anti-human CXCR4 (306506, 1:100, BioLegend) at 4 °C for 30 min before measuring fluorescence by flow cytometry.
Cell transfection
Synthetic small interfering RNA (siRNA) duplexes against human CREB1 and GPR81 were purchased from Beijing Baiaopuke Biotechnology. The siRNA sequences used were as follows: CREB1, GCCUGCAAACAUUAACCAUTT (forward), AUGGUUAAUGUUUGCAGGCCC (reverse); GPR81, GCGUGUCUGC- UAGACUCUATT (forward), UAGAGUCUAGCAGACACGCTG (reverse). dHL60 cells were seeded in the 6-well plates at the concentration of 5×105 cell/well and transfected with CREB1 siRNAs using lipofectamine 2000 transfection reagent (MF135-01, Mei5 biotechnology, Beijing, China) following manufacturer’s protocols. For transient knockdown of GPR81 in HMEC-1 cells, siRNAs were transfected using lipofectamine 3000 transfection reagent (L3000008, Invitrogen, USA) according to the manufacturer’s instruction.
ChIP (chromatin immunoprecipitation) assays
CHIP assays were performed with Simple CHIP Plus Sonication Chromatin IP Kit (56383, CST) with Rabbit monoclonal to CREB1 (9197 S, 1:50, CST). Briefly, dHL60 cells (1×107 cells) were treated with TNF or CXCL12 for 2 h at 37 °C, when the cells were collected for subsequent steps according to the manufacturer’s instructions. CHIP signals were quantified by quantitative PCR analysis. The specific primers pair for the promoter regions were described below: CXCR4, GGGCCTCAGTGTCTCTACTGT (forward), GTTTGAGGGAAGCGGGATGC (reverse). PADI4, ACGGGTTTGTCGTAATGAGC (forward), TGGGACAAGTCTCTCCACCT (reverse).
RNA sequencing and transcriptomics analysis
Total RNA of CXCR4lo and CXCR4hi neutrophils isolated from healthy controls and psoriasis patients was extracted with TRIzol (15596018CN, Invitrogen), analyzed with an Agilent 2100 Bioanalyzer (Agilent Technologies), and then quantified using Qubit 2.0 (N12391, Thermo Fisher Scientific). Sequencing libraries were generated and sequenced by GENE DENOVO (Guangzhou, China). Expression profiles of candidate genes were analyzed and visualized using Omicsmart tools. Differentially expressed genes (DEGs) from the RNA-seq data were analyzed using DESeq2 based on the criteria of false discovery rate (FDR) ≤ 0.05. Enrichment analyses for DEGs were conducted using Kyoto Encyclopedia of Genes and Genomes (KEGG) and Gene Ontology (GO) using R packages clusterProfiler, org.Hs.eg.db, enrichplot, and ggplot2. GSEA analysis was performed using GSEA 4.3.2 (http://www.broadinstitute.org/gsea/). The enriched pathways with P values were finally visualized with bubble chart and bar chart by the R language package. Correlation heatmaps were analyzed and plotted using the R programming language (version 4.2.3; heatmap package).
Single-cell RNA-seq analysis
Single-cell dataset was downloaded from https://developmental.cellatlas.io/diseased-skin26. All clusters from normal controls and psoriasis were extracted and imported to R environment (v4.0.5) through Scanpy69 (v1.9.1) and Seurat package70 (v4.1.0) using pipelines described in https://mojaveazure.github.io/seurat-disk/articles/convert-anndata.html. Then cells were calculated to acquire the percentage of CXCL12+ cells. GraphPad Prism 9.5.0 was used for data visualization.
Flow cytometry analysis of mouse skin
For the analysis of mouse skin, 1 cm × 1 cm dorsal skin was cut off and transferred to an EP tube containing 1 mL Hank’s Balanced Saline Solution (HBSS, H4641, Sigma-Aldrich). The skin was washed rigorously by quickly shaking up and down by hand for 15 s × 3 times. The skin was cut into pieces (<0.5 mm in size) in a 6-well plate placed on ice with dulbecco’s modified eagle medium (DMEM, 11885-084, Gibco) (not supplemented with FBS) containing 1 mg/mL Collagenase P (11213857001, Roche, USA) and 0.2 mg/mL DNase I (AMPD1, Sigma-Aldrich). The samples were incubated in a 37 °C cell culture incubator for 60 min and pipetted every 20 min to gently mix the cells. Cell suspensions were filtered through 40 μm cell strainer. Cells were stained with PerCP/Cy5.5 anti-mouse CD45 (103132, 1:100, BioLegend), FITC anti-mouse Ly6G (127606, 1:100, BioLegend), PE anti-mouse CXCR4 (146506, 1:100, BioLegend), and Zombie UV dye (423102, 1:500, BioLegend) in FACS buffer for 30 min and then analyzed by flow cytometry (649225, BD LSRFortessa Cell Analyzer). Data were analyzed with Flowjo v10.8.1 (Tree Star). Background fluorescence levels were determined by Fluorescence Minus One (FMO).
Analysis of cell viability and apoptosis
Viability assays were performed using the Annexin V-PE/7-AAD apoptosis kit (AP104, MultiSciences Biotech Co., Ltd.) following the manufacturer’s instructions. Neutrophils were resuspended in RPMI Medium 1640 (C11875500BT, Gibco, USA) containing 10% FBS at a concentration of 5 × 105 cells/mL and incubated for 24 h at 37 °C. Before and after incubation, cells were co-stained with FITC anti-human CD15 (301904, 1:100, BioLegend) and PE-Cy7 anti-human CXCR4 (306514, 1:100, BioLegend) for 30 min. After washing, cells were incubated with Annexin V (5 µL) and 7-AAD antibodies (10 µL) in 1 × Annexin V binding buffer for 5 min at room temperature and immediately analyzed by flow cytometry. Four cellular populations were distinguished: viable cells (Annexin V-PE and 7-AAD double-negative), early apoptotic cells (Annexin V-PE positive and 7-AAD negative), late apoptotic cells (Annexin V-PE and 7-AAD double-positive) and necrotic cells/cellular debris (Annexin V-PE negative and 7-AAD positive).
Cell transfection and dual-luciferase assay
The dHL60 cells were seeded in 6-well plates at a concentration of 5×105 cells per well and transfected with CREB1 using the lipofectamine 2000 transfection reagent (MF135-01, Mei5 biotechnology) following the manufacturer’s protocols. The CXCR4 promoter (cxcr-4‐p) construct contained the CREB1 binding site 1 (cxcr-4‐p site 1: ‐150 ~ ‐138). Sequences for the CXCR4 promoter containing the binding site were designed as follows: mutant type (MT) CXCR4 promoter: 5′- GTGGAAGACGCC-3′. The dual-luciferase reporter assay was carried out using the Dual-luciferase Reporter assay kit (D0010, Solarbio technology). Luciferase activity was measured as the ratio of firefly luciferase signal to Renilla luciferase signal.
Cell culture and treatment
Human microvascular endothelial cell line (HMEC-1 cell, CRL-3243) was purchased from American Type Culture Collection (ATCC, USA) and cultured as required. Cells were seeded in 6-well plates and cultured until they reached 80% – 90% confluence, followed by co-incubation with human CXCR4lo and CXCR4hi neutrophils (2×105/well), or LDHA inhibitor (LDHA-IN-3, 50 µM, MCE) at 37 °C for 6 h, DMSO alone served as vehicle control. For the expression of CXCL12 in HMEC-1 cells, cells were seeded in 6-well plates and cultured until they reached 60% – 70% confluence, followed by co-incubation with pro inflammatory cytokines (IL17A for 50 ng/ml, IL22 for 20 ng/ml, oncostatin M for 20 ng/ml, TNF 50 ng/ml, and IL1α for 20 ng/ml), healthy serum and psoriatic serum (20%) at 37 °C for 24 h. Cells were washed with PBS and harvested for further experiments.
HL-60 cell lines (CL-0110) were obtained from Procell (Wuhan, China) and cultured as required. Differentiation of HL60 cells into neutrophil-like cells (dHL-60) was induced by culturing in a CO2 incubator for 6 days in the presence of 1.25% DMSO. Morphology analysis with microscopy was used for cell line authentication. All cell lines were tested negative for Mycoplasma contamination.
ROS detection
For ROS analysis, 5 × 105 neutrophils were isolated from healthy controls and psoriasis patients and treated with phorbol 12-myristate 13-acetate (PMA, 50 nM, P1585, Sigma-Aldrich) at 37 °C for 30 min, then cells stained with FITC anti-human CD15 (301904, 1:100, BioLegend) and PE-Cy7 anti-human CXCR4 (306514, 1:100, BioLegend), and intracellular ROS production was measured by a dihydroethidium probe kit (BB-47051, DHE, BestBio, Beijing, China) at 37 °C for 30 min. After washing, the cells were immediately analyzed by flow cytometry.
Degranulation
Degranulation of neutrophils was assessed by monitoring the cell surface expression of CD63. Blood samples obtained from healthy controls and psoriasis patients were collected and red blood cells were removed using Red Blood Lysing Buffer (FXP001, 4 A Biotech Co., Ltd). Then cells were labeled with FITC anti-human CD15 (301904, 1:100, BioLegend), PE-Cy7 anti-human CXCR4 (306514, 1:100, BioLegend) and PE anti-human CD63 (353004, 1:100, BioLegend) at 4 °C for 30 min. After three washes, cells were resuspended in PBS and analyzed using flow cytometry (649225, BD LSRFortessa Cell Analyzer), Background fluorescence levels were determined by Fluorescence Minus One (FMO).
Wright-Giemsa Staining
Wright-Giemsa staining was performed to analyze the morphology of freshly isolated peripheral CXCR4lo and CXCR4hi neutrophils obtained from healthy controls and psoriasis patients. The cells were resuspended in an autologous red blood cell suspension with plasma and stained using the Wright-Giemsa (G5637, Sigma-Aldrich) following the manufacturer’s instructions. The resulting smears were examined under a microscope to assess the morphological features of the neutrophils.
Endothelial permeability measurements
Endothelial permeability measurements were performed using a Transwell system with HMEC-1 cells seeded in the upper chamber with a 5.0 µm pore size (CLS3421, Corning, USA) until they reached 90% confluence. Freshly isolated CXCR4lo and CXCR4hi neutrophils from healthy controls and psoriasis patients (1×105/well) were added to the upper chamber and co-incubated at 37 °C for 6 h. LDHA-IN-3 (50 μM, MCE) was added to block lactate activity. Transwell inserts without stimulation or with DMSO were used as controls. After 6 h, the culture medium was removed and washed with free-cell medium three times. Next, 50 µl of FITC-labeled dextran (D1844, 2.5 mg/mL, 40 kDa, Invitrogen) was added to the upper chamber as a tracer. After 2 h, 100 µl samples were collected from the lower chamber and fluorescence spectrophotometry was performed with an excitation wavelength of 494 nm and an emission wavelength of 521 nm (spectrofluorometer, Varioskan LUX 3020-265, Thermo Scientific) to measure the permeability of the endothelial monolayer.
Skin histopathology
Fixed examples were embedded in paraffin and the 4 μm sections were stained with hematoxylin and eosin (H&E) for histological analysis. Slides were scanned into digital section by slide scanner and analyzed by NDP2 viewer software (HAMAMATSU Photonics). The dermal vascular area in H&E-stained sections was quantified.
Immunofluorescence staining
For tissue specimens, paraffin-embedded sections (4 μm) were deparaffinized and rehydrated. For cultured cells (HMEC-1 cells) in coverslips, they were fixed with 4% paraformaldehyde for 15 min, and permeabilized with 0.2% Triton X-100 (93443, Sigma-Aldrich) for 10 min. After incubation in goat serum for 1 h at room temperature, the skin sections or the cells were incubated with primary antibodies overnight at 4 °C. The following antibodies were used: Rat monoclonal to Ly6G (sc-53515,1:100, Santa), Rabbit monoclonal to phospho-CREB1 (9198 S, 1:400, CST), Mouse monoclonal to CD15 (241552, 1:100, Abcam), Rabbit monoclonal to CD15 (135377, 1:100, Abcam), Rabbit monoclonal to CXCR4 (181020, 1:100, Abcam), Mouse monoclonal to CXCR4 (60042-1-1 g,1:100, Proteintech, Wuhan, China), Goat polyclonal to CXCR4 (GTX21671, 1:100, GenTex, USA), Mouse monoclonal to CD31 (199012, 1:200, Abcam), Rabbit polyclonal to GPR81 (PA5-114741, 1:100, Invitrogen), Rabbit monoclonal to Vimentin (16700, 1:500, Abcam), Rabbit polyclonal to CXCL12 (17402-1-AP, 1:100, Proteintech), Rabbit polyclonal to ZO-1 (96587, 1:100, Abcam), Rabbit polyclonal to VE-cadherin (33168, 1:100, Abcam), and Rabbit monoclonal to Occludin (216327, 1:100, Abcam). The samples were washed with PBS buffer for three times. The corresponding fluorescent-labeled secondary antibody was further incubated at room temperature for 1 h, then washed with PBS buffer for 10 min × 3 times. After incubation with Hoechst 33258 (C0021, 1:1000, Solarbio technology), the samples were observed with a confocal microscope (LSM880, Carl Zeiss).
For immunofluorescence in neutrophils, cells were fixed, permeabilized and incubated as described above. The following primary antibodies were used: Rabbit monoclonal to phospho-CREB1 (9198 S, 1:400, CST), Rabbit monoclonal to LDHA (3582 S,1:200, CST), Mouse monoclonal to CXCR4 (60042-1-1 g, 1:100, Proteintech), Goat polyclonal to CXCR4 (GTX21671, 1:100, GenTex), Mouse monoclonal to LAMP1 (25630, 1:400, Abcam), Mouse monoclonal to CBP (MA5-13634, 1:500, Thermo Fisher Scientific), Mouse monoclonal to MMP-9 (58803,1:100, Abcam) and Mouse monoclonal to LCN2 (23477, 1:400, Abcam). After incubation with the corresponding secondary antibodies and Hoechst 33258 (C0021, 1:1000, Solarbio technology), the cells were resuspended in 100 μl PBS and placed overnight in coverslips for following confocal microscope (LSM880, Carl Zeiss).
For multiplex fluorescence staining, the staining kit was purchased from four-color multiple fluorescent immunohistochemical staining kit (abs50012, Shanghai, China). Paraffin sections were heated at 80 °C for 10 min and dewaxed in xylene, gradient alcohol dehydration, 10% neutral formalin immersion for 10 min; antigen was repaired in EDTA solution using microwave repair and cooled to room temperature. Endogenous peroxidase activity was first blocked with 0.3% hydrogen peroxide for 10–15 min, followed by blocking of non-specific sites with 10% goat serum for 30 min. Mouse monoclonal to CD15 (241552, 1:100, Abcam) was incubated overnight as an antibody; the secondary antibody was incubated for 10 min and then incubated with fluorescent dye for 10 min. After the microwave repair was cooled to room temperature, the above steps were repeated again to complete the staining of Mouse monoclonal to CD31 (199012, 1:200, Abcam), Rabbit polyclonal to GPR81 (PA5-114741, 1:100, Invitrogen), Rabbit monoclonal to Vimentin (16700, 1:500, Abcam), Rabbit polyclonal to CXCL12 (17402-1-AP, 1:100, Proteintech), or Rabbit monoclonal to CXCR4 (181020, 1:100, Abcam), and finally incubated with DAPI for 5 min to stain the nucleus and anti-fluorescence quencher seal. The expression was observed under fluorescence microscope (LSM880, Carl Zeiss).
Visualization and quantification of NETs
CD15+CXCR4lo and CD15+CXCR4hi neutrophils from healthy controls and psoriasis patients were re-suspended in RPMI Medium 1640 (C11875500BT, Gibco) and were seeded on poly-Llysine (P4832, Sigma-Aldrich)-coated coverslips (105 cells/well). Cells were incubated for 4 h to assess their ability to form NETs at 37 °C. To block p-CREB1 signaling pathway, psoriatic CD15+CXCR4hi neutrophils were treated with DMSO vehicle or 300 μM KG-501 (HY-103299, MCE). Neutrophils were fixed with 4% paraformaldehyde and permeabilized with 0.2% Triton X-100 (93443, Sigma-Aldrich). Cells were blocked with 3% BSA in PBS for 2 h at room temperature, and then cells were incubated with Rabbit polyclonal to citrullinated histone-3 (5103, 1:200, Abcam) and Mouse monoclonal to MPO (25989, 1:100, Abcam) at 4 °C overnight. Secondary antibody conjugated with Goat anti-Mouse IgG cy3 (97035, 1:1000, Abcam) or Goat anti-Rabbit IgG Alexa Fluor 488 (150077, 1:1000, Abcam) were then used. Cells were washed and stained with Hoechst 33258 (C0021, 1:1000, Solarbio technology) and subsequently analyzed by a confocal microscope (LSM880, Carl Zeiss). NETs quantification in immunofluorescence referred to previous study71 in which the NETs were counted as extracellular citrullinated histone-3-positive cells at least three representative immunofluorescence images (from two neighboring sections) per sample. Then neutrophils were counted as MPO-positive cells at the same images. The percentage of NETs-forming neutrophils was calculated using the formula: (number of NETs-forming neutrophils/number of neutrophils) ×100. All values were determined by two pathologists who were blind to clinical or experimental information.
Western Blot analysis
Human neutrophils and cultured cells treated with various reagents were washed and lysed in RIPA buffer (P0013C, Beyotime, Shanghai, China). After incubation at 4 °C for 30 min, protein lysates were centrifuged at 12,000 × g for 15 min and supernatants was collected for concentration determination with the BCA Protein Assay Kit (PA115-02, TIANGEN, Beijing, China). The culture supernatants of CXCR4lo and CXCR4hi neutrophils were collected and purified using the ammonium sulfate method. Salt (0.431 g/ml) was added slowly while stirring the supernatant, and precipitation was performed at 4 °C overnight. The protein precipitates were obtained by centrifugation at 13,000 g for 15 min at 4 °C, dissolved in PBS, and dialyzed in deionized water. The corresponding CXCR4lo and CXCR4hi neutrophils were also extracted for the detection of GAPDH.
Briefly, equivalent amounts of protein were separated on 10% SDS–PAGE and transferred to PVDF membranes. Then the membranes were blocked with blocking buffer for 1 h, and incubated with primary antibody: Rabbit polyclonal to ZO-1 (96587, 1:1000, Abcam), Rabbit polyclonal to VE-cadherin (33168, 1:1000, Abcam), Rabbit monoclonal to Occludin (216327, 1:1000, Abcam), Mouse monoclonal to GAPDH (60004-1-Ig, 1:5000, Proteintch), Mouse monoclonal to PADI4 (128086, 1:1000, Abcam), Rabbit polyclonal to citrullinated histone-3 (5103, 1:1000, Abcam), Rabbit monoclonal to CREB1 (9197 S, 1:1000, CST), Goat polyclonal to GPR81 (106942, 1:500, Abcam), Rabbit monoclonal to phospho-CREB1 (9198 S, 1:400, CST), Mouse monoclonal to CBP (MA5-13634, 1:1000, Thermo Fisher Scientific), Mouse monoclonal to MMP-9 (58803,1:100, Abcam) and Mouse monoclonal to CXCR4 (60042-1-Ig, 1:1000, Proteintech) at 4 °C overnight. Then membranes were incubated with secondary antibody conjugated with anti-rabbit or anti-mouse horseradish peroxidase, for 1 h at room temperature. Blots were detected using an enhanced chemiluminescence detection kit (GTX14698, GeneTex). Intensities of the bands were quantified by Image Lab (Bio-Rad Laboratories, Inc., version 5.2.1). The uncropped and unprocessed scans were supplied in the Source Data file and Supplementary Information.
Cell adhesion assay
HMEC-1 cells were seeded in a 15-mm glass bottom cell culture dish (801002, NEST, Wuxi, China) and cultured until they reached 80% confluence. Freshly isolated CXCR4lo and CXCR4hi neutrophils (105 cells/well) from healthy controls and patients with psoriasis were then added into the culture dish. Cells were incubated at 37 °C for 2 h and then incubated with Hoechst 33258 (C0021, 1:1000, Solarbio technology) for 15 min in dark. After washing twice with PBS and subsequently analyzed by a confocal microscope (LSM880, Carl Zeiss).
Enzyme-linked immunosorbent assay (ELISA)
CXCL12 (E-EL-H0052c, ElabScience, Wuhan, China), IL17A (E-EL-H5812c, ElabScience), MPO (ab119605, Abcam), and MMP-9 (E-EL-H6075, ElabScience) levels in blood plasma samples were measured using ELISA kits according to the manufacturer’s instructions. In brief, samples or standards were added to the wells and incubated for 90 min at room temperature. After washing, a working detector was added to each well, followed by the addition of the substrate solution. The reaction was stopped, and the absorbance was read at 450 nm. The amount was calculated using a standard curve and GraphPad Prism 9.5.0.
RNA isolation and quantitative RT-PCR
RNA was extracted by standard procedure with TRIzol reagent (15596018CN, Invitrogen). The RNA concentrations and purity were measured spectrophotometrically (N12391, Thermo Fisher Scientific, Inc.) and qRT-PCR was performed with SYBR Green Master Mix (RR820A, TaKaRa, Japan) in 384-well plates according to the manufacturer’s instructions. Data analysis of mRNA expression was normalized to the internal control β-actin and quantified by the 2–ΔΔCt method. All primers used for RT-PCR are listed in Supplementary Table 2.
Statistics and Reproducibility
Statistical analyses were performed using GraphPad Prism 9.5.0 (GraphPad Software, Inc., USA) and R software (R Statistical Software, version 4.2.3). Experimental data were analyzed using two-tailed paired and unpaired Student t test, one-way or two-way ANOVA. Two-sided Tukey’s multiple comparison test was used for multiple comparisons. Differentially expressed genes (DEGs) from the RNA-seq analyses were identified using the R “DEseq2” package with a threshold of |logFC | >1 and false-discovery rate (FDR) < 0.05. The Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analyses were carried out using R “clusterProfiler”, “enrichplot”, and “ggplot2” packages. Bar chart, bubble chart, and correlation heatmaps were mapped using R programming language. P < 0.05 considered statistically significant. All in vitro and in vivo experiments were repeated at least twice independently with similar results.
Reporting summary
Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.