Deletion of endothelial leptin receptors in mice promotes diet-induced obesity – Scientific Reports

Experimental animals

The generation of mice with tamoxifen-inducible, Tie2.Cre-ER^T2-mediated deletion of LepR in endothelial cells was described previously^12,17. For Cre recombinase activation, mice (6 weeks-of-age) were fed tamoxifen citrate-containing rodent chow (Envigo; TD.130860) for 6 weeks⁴⁹. Genomic DNA from the brain, lung, small intestine, subcutaneous adipose tissue (SCAT) and visceral adipose tissue (VAT) was isolated using Direct PCR lysis reagent (Peqlab) containing 0.2 mg/mL proteinase K (Peqlab). The mouse genotype was determined using the following primers: Tie2.Cre (Tie2Cre1: 5′-CGA GTG ATG AGG TTC GCA AG-3′; Tie2Cre2: 5′-TGA GTG AAC GAA CCT GGT CG-3′); LepR (LepRflox1: 5′-GTC ACC TAG GTT AAT GTA TTC-3′; LepRflox2: 5′-TCT AGC CCT CCA GCA CTG GAC-3′. Tamoxifen-induced deletion of LepR gene was confirmed using the primers: LepRflox1: 5′-GTC ACC TAG GTT AAT GTA TTC-3′ and LepR delta/∆: 5′-GCA ATT CAT ATC AAA ACG CC-3′). Sex-matched littermate Tie2.ER^T2-WT LepR^flox/flox mice, fed tamoxifen-containing rodent diet, were used as controls throughout the entire study.

High-fat diet-induced obesity model

Following tamoxifen diet, littermate male and female mice were fed standard laboratory diet (SD) for mice (V1124-300; ssniff^®) for 2 weeks and then switched to 45 kcal-% HFD (D12451; Research Diets) ad libitum to induce obesity. Body weight was determined before and every 4 weeks for a total of 16 weeks. All experimental procedures involving animals had been á priori approved by the local animal ethics committee (Translational Animal Research Center, University Medical Center Mainz) and the Landesuntersuchungsamt Rheinland-Pfalz (animal permit G16-1-081) and complied with national guidelines for the care and use of laboratory animals. The study is reported in accordance with ARRIVE guidelines.

Indirect calorimetry

To continuously and simultaneously measure the energy expenditure, physical activity, O₂ consumption and CO₂ production as well as food and water intake, a subset of mice on SD was transferred to metabolic cages (Promethion High-Definition Multiplexed Respirometry Cage; Sable Systems™). Each cage was lined with Aspen chips, food hopper and water bottle connected to a food/water intake monitoring system built into the cage lid. Physical activity was monitored in real time using the BXYZ beam break activity monitor system. After an equilibration period of 5 days to standard animal housing conditions, metabolic parameters were recorded over 7 days on SD followed by 45% HFD for additional 7 days. The temperature was kept constant at 22 °C, and lights were set to on and off at 6:00 and 18:00 h respectively, to maintain 12 h light–dark cycles and correlate activity patterns with circadian cycles. Per each experiment (n = 3 experimental replicates), End.LepR-WT and End.LepR-KO (n = 4 mice per experiment) were studied. The CalR web tool was used to analyze the indirect calorimetry raw data for generating plots and statistical analysis. Metabolic parameters were normalized to the respective individual body weight of mice recorded at the start of the equilibration stage⁶³.

Glucose tolerance testing

In subsets of littermate mice, glucose tolerance tests were performed after being fed SD or HFD for 14 weeks. Following the removal of food for 6 h (with drinking water ad libitum), as recommended for metabolic studies in mice⁶⁴, mice were injected intraperitoneally with a 20% glucose solution at a dose of 2 g/kg body weight (volume of i.p glucose injection (μL) = 10 × body weight (g)), and (tail vein) blood glucose levels were determined before and 15, 30, 60 and 120 min after the glucose administration using the CONTOUR^® NEXT blood glucose monitoring system (Ascensia Diabetes Care Holdings).

Tissue harvest

After 16 weeks of HFD, mice were deeply anesthetized (using a mixture of ketamine hydrochloride [75 mg/kg body weight] and xylazine hydrochloride [15 mg/kg body weight)] in 0.9% sodium chloride solution), and whole blood was taken by cardiac puncture to measure fasting glucose levels, as above. The rest was allowed to clot for 30 min at room temperature followed by serum preparation. Mice were killed by cervical dislocation under deep anesthesia. Their brain, visceral perigonadal adipose tissue (VAT) and liver were removed, weighed and prepared for subsequent molecular or histological analyses, or endothelial cell isolation. In some mice, rhodamine-labeled leptin (FR-003-13, Phoenix Pharmaceuticals; 5 mg/kg body weight) was injected 45 min before tissue harvest via intraperitoneal (i.p.) injection. Then, fluorescein-labeled Lectin I from Griffonia Simplicifolia (FL-1201, Vector Laboratories) was injected intracardially (i.c.) 15 min before tissue harvest to label functional blood vessel and microglial cells in vivo. Tissues were prepared for cryo-preservation and fluorescence microscopy analysis.

Determination of serum metabolic parameter

Serum was prepared by centrifugation at 3000 rpm for 10 min and stored at − 80 °C pending analysis. Fasting serum glucose was measured using colorimetric assays (BioAssay Systems). Commercial enzyme-linked immunoassays were employed to determine circulating levels of murine leptin (R&D Systems Inc; detection range: 1.58–5.56 pg/mL), soluble leptin receptor (sLepR; antibodies online, ABIN773812) or insulin (Crystal Chem, #90060; detection range: 0.1–12.8 ng/mL), according to the manufacturer’s instructions.

Histological and immunohistochemical analysis

For the preparation of paraffin-embedded tissue sections and histology, a portion of VAT was fixed overnight in 4% zinc formalin (Sigma) followed by incubation in 70% ethanol (Carl Roth) and embedded in paraffin (Surgipath^® Paraplast; Leica Biosystems). Five µm-thick serial cross sections were deparaffinized and stained with hematoxylin and eosin (H&E) to measure the single adipocyte area. For immunohistochemistry, deparaffinized sections were washed in a series of graded alcohol followed by heat-induced antigen retrieval (in 0.01 M citrate buffer, pH 6.0 for 6 min) prior to blocking with 10% normal serum (abcam). Sections were incubated overnight at 4 °C with primary rat monoclonal antibody against Mac2 (CL8942AP; Cedarlane Laboratories; dilution, 1:400 in antibody diluent (Dako)). For detection, sections were incubated with secondary antibody (dilution: 1:1000; Molecular Probes) followed by avidin–biotin complex (Vector Laboratories) and amino ethyl carbazole substrate (abcam) until color development. Sections were briefly counterstained with Gill’s hematoxylin (Sigma), mounted in ImmuMount (ThermoScientific) and photographed at 20 × magnification (Olympus BX51 microscope). Mac2-immunosignals were quantified as percentage of total area using Image-Pro Plus (version 7.0) software (Media Cybernetics Inc.). For cryo-preservation and the preparation of cryo sections, tissues were immediately embedded in Tissue-Tek O.C.T. compound (Sakura via Science Services GmbH). To analyze lipid accumulation in liver, eight-micrometer thick cryo-sections were fixed in 4% formaldehyde for 15 min, washed three times in 1 × PBS followed by 0.5% Oil red O (Sigma) staining for 1 h at room temperature. The tissues were washed, counterstained with hematoxylin and photographed at 20 × magnification at an inverted light microscope (Motic AE31, Motic).

Morphometric analysis

The single adipocyte area was determined, as previously described⁶⁵. In brief, 5 µm-thick cross sections through VAT were stained with H&E and photographed at 10 × magnification using an Olympus BX51 microscope. Five representative images were captured from each cross section, and at least 10 adipocytes per image were randomly selected and measured using image analysis software (Image-Pro Plus, version 7.0). Results were averaged per mouse. The Oil red O-positive area on liver sections was determined on 5 images per each animal and the results averaged per mouse.

Immunofluorescence microscopy analysis

For immunofluorescence analysis, 8 µm-thick cryo-sections were processed, as described below. Sections were defrosted for 5 min at room temperature and washed (2 × 5 min) with 1 × PBS (pH 7.5) followed by fixation in ice-cold acetone (PanReac AppliChem) for 10 min at − 20 °C. Sections were washed and rehydrated with 1 × PBS (3 × 5 min) and permeabilized in 0.05% Triton X-100 (in PBS; Roth) for 10 min at 37 °C. Primary antibody was diluted in antibody diluent (Dako), and sections were incubated overnight at 4 °C. The following primary antibodies were used: anti-Mac2 (CL8942AP; Cedarlane Laboratories), anti-CD206 (ab64693; abcam), anti-VEGF (ABS82, Millipore), anti-LepR (AF498; R&D Systems), and anti-CD31 (sc18916; Santa Cruz Biotechnology). Sections were washed with PBS, followed by incubation with the secondary antibody in 1 × PBS for 2 h at room temperature in the dark. The following secondary antibodies used were: Alexa Fluor™ Plus 647 donkey anti-goat (A32849; Life Technologies), Alexa Fluor™ 488 goat anti-rat (ab150157; abcam), Alexa Fluor™ 555 goat anti-rat (ab150154; abcam), Alexa Fluor™ Plus 488 goat anti-rabbit (A32731, Life Technologies) and Alexa Fluor™ Plus 555 goat anti-rabbit (A32732; Life Technologies). Cell nuclei were visualized using 4′, 6-diamidino-2-phenylindole (DAPI; Sigma). To exclude nonspecific immunostaining, sections were incubated with secondary antibodies alone. Images were acquired using an inverted fluorescence microscope (Keyence; BZ-X810) equipped with a 40 × objective lens and BZ-X800 image software. Immunosignals were quantified using Image-Pro Plus software on at least 5 images per animal, and the results averaged per mouse.

Mouse endothelial cell isolation and culture

Primary murine endothelial cells (mPECs) were isolated from the brain, lungs and VAT. Primary endothelial cells from the brain and VAT were isolated using Papain Dissociation System (Worthington), according to the protocol provided in the datasheet. Primary murine endothelial cells from lungs of End.LepR-WT and End.LepR-KO mice were isolated using magnetic cell sorting with mouse CD31 microbeads (Miltenyi Biotec), as described previously¹⁰. Cells were cultured on 0.1% gelatin-coated cell culture plates and maintained in endothelial cell growth medium MV2 (PromoCell) until confluency. Cells were analyzed between passages 0 and 2.

Endothelial metabolic measurements

To study the total ATP production rate from glycolysis and mitochondrial respiration in live endothelial cells, Seahorse XFp Real-Time ATP Rate Assay was performed using the Seahorse XF96e Extracellular Flux analyzer (Agilent Technologies). One day prior to performing the assay, endothelial cells were plated into gelatin-coated XF96 (V3) polystyrene cell culture plates (Agilent Technologies) and cultured in MV2 medium (PromoCell). After 24 h, medium was changed to XF assay medium (XF RPMI with 1 mM HEPES; Agilent Technologies; #103576-100), supplemented with 1 mM pyruvate, 2 mM l-glutamine and 25 mM glucose (all Sigma-Aldrich), and cells incubated at 37 °C in a SpectraMax i3 (VWR; INCU-Line) used as non-CO₂ incubator for 45 min, while conduction bright field imaging to document homogenous seeding of cells. After calibration and initialization of the sensor cartridge, three baseline measurements were recorded, prior to the addition of each compound, and three response measurements after sequential injections of the ATP synthase inhibitor oligomycin (1.5 μM) from port A, the complex 1 inhibitor rotenone (0.5 µM) and the complex 3 inhibitor antimycin A (0.5 μM), both from port B. After completion of the assay, cells were stained with BioTracker NIR694 Nuclear Dye (Sigma, #SCT118) and counted for normalization using the SpectraMax MiniMax 300 Imaging Cytometer (Molecular Devices). Cell nuclei were automatically identified using the SoftMaxPro 6.5.1 software by setting size and threshold for object identification in the red channel. Data analysis was performed using Wave 2.6.3.5 Software (Agilent Technologies).

RNA isolation and quantitative real time PCR analysis

Total RNA was isolated from primary murine endothelial cells using TRI Reagent^® (Ambion) solution, as previously described¹⁰. To isolate total RNA from adipose tissue, freshly harvested murine VAT was cut into small pieces and transferred to a 2 mL RNase/DNase free tube containing 0.5 mL of TRI Reagent and mechanically homogenized (Miccra homogenizer) on ice. The homogenate was centrifuged at 12,000×g for 15 min to remove the lipid fraction on the surface of the aqueous phase. The aqueous phase was then transferred to a fresh 1.5 mL tube followed by subsequent RNA isolation steps of phase separation using 100 µL chloroform, mixed vigorously and centrifuged at 12,000×g at 4 °C for 15 min. The aqueous layer was transferred to a fresh tube with 500 µL of isopropyl alcohol and mixed to precipitate the RNA. After 20 min of incubation on ice, precipitated RNA was spun down at 12,000×g at 4 °C for 10 min. The RNA pellet was washed twice with 75% ethanol and air-dried before being dissolved in RNAse-free water. The concentration and quality of the isolated RNA was checked by spectrometry (Nanodrop; Thermo Scientific). One μg total RNA was reverse transcribed into cDNA using M-MLV reverse transcriptase (Promega) after DNase treatment (Sigma). Quantitative real-time RT-PCR (qRT-PCR) was performed using SYBR^® Green (BioRad) and CFXConnect Real-Time PCR Detection System (BioRad). Results were quantified using the ΔΔCt method. Threshold values (C_t) of genes of interest were first normalized to the reference genes C_t values to obtain ΔC_t values (= C_t gene of interest − C_t of reference gene) using actin (ACTA; for endothelial cells) or ribosomal protein lateral stalk subunit P0 (RPLP0; for adipose tissue). To compare the expression pattern of genes in End.LepR-KO mice to WT mice, 2^−ΔΔCt values were calculated and expressed as -fold change to wild type mice (= ΔC_t of End.LepR-KO/ΔC_t of End.LepR-WT). The primer sequences used for real-time PCR were: LepR short isoform: for—GAA GTC TCT CAT GAC CAC TAC AGA TGA and rev—TTG TTT CCC TCC ATC AAA ATG TAA; LepR long isoform: for—GCA TGC AGA ATC AGT GAT ATT TGG and rev—CAA GCT GTA TCG ACA CTG ATT TCT TC; fatty acid binding protein-4 (Fabp4): for—GAT GCC TTT GTG GGA ACC TGG and rev—TTC ATC GAA TTC CAC GCC CAG; catenin beta-1 (Ctnnb1): for—TTA AAC TCC TGC ACC CAC CAT and rev—AGG GCA AGG TTT CGA ATC AA; Ccnd1; for—GTT CGT GGC CTC TAA GAT GAA GGA and rev—CAC TTG AGC TTG TTC ACC AGA AGC; perilipin-1 (Plin1): for—CTT TCT CGA CAC ACC ATG CAA ACC and rev—CCA CGT TAT CCG TAA CAC CCT TCA; leptin (Lep): for—GGA TCA GGT TTT GTG GTG CT and rev—TTG TGG CCC ATA AAG TCC TC; Pdgfra: for—TAT CCT CCC AAA CGA GAA TGA GA and rev—GTG GTT GTA GTA GCA AGT GTA CC; Pparg: for—CTCACAATGCCATCAGGTTT and rev—CTC TTG CAC GGC TTT CTA CGG; Pref1: for—CGT GAT CAA TGG TTC TCC CT and rev—AGG GGT ACA GCT GTT GGT TG; glucose transporter member 1 (Glut1): for—GCA GTT CGG CTA TAA CAC TGG and rev—GCG GTG GTT CCA TGT TTG ATT G; or isocitrate dehydrogenase (Idh): for—GGA GAA GCC GGT AGT GGA GA and rev—GGT CTG GTC ACG GTT TGG A; or sirtuin-3 (Sirt3): for—ATC CCG GAC TTC AGA TCC CC and rev—CAA CAT GAA AAA GGG CTT GGG; Nos3: for—GAC CCT CAC CGC TAC AAC AT and rev—CTG GCC TTC TGC TCA TTT TC; Sele: for—ATG CCT CGC GCT TTC TCT C and rev—GTA GTC CCG CTG ACA GTA TGC; and Vcam1: for—CTT CAT CCC CAC CAT TGA AG and rev—TGA GCA GGT CAG GTT CAC AG.

Flow cytometry analysis

Freshly harvested VAT was transferred to ice-cold PBS, minced and digested in collagenase solution (1 mg/mL collagenase II in RPMI medium) at 37 °C for 1 h with constant shaking (ThermoMixer^® C; Eppendorf). After 1 h, the tissue was passed through a 70 μm cell strainer (greiner bio-one) to remove undigested cell debris and washed with FACS buffer (1% FBS, 2 mM EDTA in PBS) to collect the adipocytes. An equal number of cells were incubated for 10 min with unlabeled monoclonal antibody (mAb) against CD16/CD32 (eBioscience) to block nonspecific Fc receptor-mediated binding. Monocyte and macrophages were stained for 30 min with allophycocyanin (APC)-eFluor-780 or BV/11-labeled anti-mouse CD45 and Fixable Viability Dye eFluor506, APC-labeled anti-mouse CD11b, PE-labeled anti-mouse CD115, PerCP-Cy5.5-labeled anti-mouse Ly6C, BV650-labeled anti-mouse CD11c, Pacific Blue-labeled anti-mouse F4/80, fluorescein isothiocyanate-labeled anti-mouse CX3CR1, and APC-Cy7-labeled anti-mouse major histocompatibility complex (MHC) class II. T cells, B cells, NK cells, and polymorphonuclear leukocytes were excluded by staining with PE-Cy7-labeled anti-B220, anti-CD3, anti-NK1.1, and Ly6G antibodies (all from BioLegend). All flow cytometry measurements were performed on a BD LSR II (Becton Dickinson, Heidelberg, Germany). Flow Jo Version 10 was used for data analysis.

Statistical analysis

Quantitative data are presented as mean ± standard deviation. Normal distribution was examined using the Shapiro–Wilk normality test. Differences between two groups were tested by Student’s t test for unpaired means or Mann–Whitney test, if normal distribution was not confirmed. If more than two groups were compared, One-Way or Two-Way Analysis of Variance (ANOVA) followed by Sidak’s Multiple Comparison test was performed if values were normally distributed, or Kruskal–Wallis test followed by Dunn’s multiple comparisons test, if not. For the comparison of two groups at different time points, Two-Way ANOVA was employed. Statistical significance was assumed if P reached a value < 0.05. All analyses were performed using GraphPad PRISM data analysis software (version 9.0 for Windows; GraphPad Software Inc.).