Reagents
The following primary antibodies and dilutions were used: FARSA (18121-1-AP; WB 1:1000; IF/PLA 1:500), FARSB (16341-1-AP; WB 1:1000; IF/PLA 1:500), TAOK1 (23379-1-AP; WB 1:1000, IF/PLA 1:500), CNP (13427-1-AP; WB 1:1000), CYFIP1/2 (16011-1-AP; WB 1:1000), GAPDH (60004-1-Ig, lot: 10013030 and 10494-1-AP; WB 1:5000), TSPAN5 (12122-1-AP; WB 1:500), PXMP2 (24801-1-AP; WB 1:600), LARS (21146-1-AP; WB 1:500, PLA 1:100), NARS (14882-1-AP; WB 1:500, PLA 1:100), EPRS (25307-1-AP; WB 1:500, PLA 1:100), HA (66006-2-ig, lot: 10011878; WB, 1:1000) (all from Proteintech, Rosemont, Illinois, USA); HNRNPL (sc-32317, lot: 4D11; WB 1:500, IF 1:100), HNRNPK (sc-28380, lot: D-6; WB 1:500, IF 1:100), NPM1 (sc-56622; WB 1:100), Lamin B1 (sc20682, lot: H90; WB 1:5000), Syp/Synaptophysin (sc-17750, lot: D0419; WB 1:1000) (all from Santa Cruz Biotechnology, Dallas, Texas, USA); Histone H3 (NB500-171; WB 1:1000), ALG10B (NBP3-09560; WB 1:500) (all from Novus Biologicals, Centennial, Colorado, USA; Anti-Biotin antibody [Hyb-8] (ab201341, lot: GR3446252-1; PLA 1:100), TDP-43 (ab80608; lot: GR83948-15; ICC 1:250) (all from Abcam, Cambridge, UK); Anti-biotin Rabbit mAb (5597 S, lot: D5A7, Cell Signaling Technology, Danvers, Massachusetts, USA, PLA 1:100); GOLT1B (PA5-103499 Invitrogen, Waltham, Massachusetts, ZDA; WB 1:1000, WB-tissue 1:500); GOLT1B (HPA055909: WB 1:1000), PABPC1 (P6246, lot: 015M4782V; ICC 1:250) (all from Sigma Aldrich, St. Louis, Misuri, ZDA). The following secondary antibodies were used: Alexa Fluor 488 (4408; dilution 1:1000), Alexa fluor 488 (A21202; dilution 1:1000), Alexa Fluor 555 (A31572; dilution 1:1000), Alexa Fluor 647 (A21447; dilution 1:1000) (all from Cell Signaling Technology, Danvers, Massachusetts, USA) StarBright Blue 520 (#12005866, #12005869), StarBright Blue 700 (#12004158, #12004161) Fluorescent Secondary Antibodies (all from Bio-Rad, Hercules, California, USA; dilution 1:5000); Peroxidase AffiniPure Goat Anti-Rabbit IgG (H + L) (111-035-045), Anti-Mouse IgG (H + L) (115-035-044) (both from Jackson ImmunoResearch, West Grove, Pennsylvania, USA; dilution 1:5000). Control antibody for RNA immunoprecipitation assay was Normal Rabbit IgG (12-370, Millipore, Burlington, Massachusetts, USA).
Biological resources
C9orf72 patient-derived fibroblasts were a kind gift from Dr. Don W. Cleveland (Ludwig Institute for Cancer Research, La Jolla, California, USA)43. Control fibroblasts were obtained from skin biopsies of healthy volunteers and approved by the Ethical Committee (EK45022009) of the Technische Universität Dresden, Germany and prepared as previously described62. They were cultured in high-glucose Dulbecco’s modified Eagle’s medium with GlutaMax (DMEM) supplemented with 20% fetal bovine serum (FBS) and 100 U/mL penicillin/streptomycin (P/S) (all from Gibco, Thermo Fisher Scientific, Waltham, Massachusetts, USA). C9orf72 patient-derived and control lymphoblastoid cell lines were prepared from patients segregating C9orf72 mutations as previously described63. They were cultured in RPMI 1640 (Gibco, Thermo Fisher Scientific, Waltham, Massachusetts, USA) supplemented with 15% FBS and 100 U/mL P/S. C9orf72 patient-derived (cell line CS52iALS-C9n6) and isogenic control (cell line CS52iALS-C9n6.ISOC3) induced pluripotent stem cells (iPSCs) were purchased from Cedars-Sinai Medical Center (LA, California, USA). These iPSCs were cultured on Matrigel (Corning Life Sciences, Glendale, Arizona, USA) in mTeSR1 medium (STEMCELL Technologies, Vancouver, Canada). HEK293T (ATTC, CRL-3216) and HEK293 (ATTC, CRL-1573) cells were cultured in DMEM supplemented with 10% FBS and 100 U/mL P/S. All cell lines were maintained in a humidified atmosphere containing 5% CO2 at 37 °C. NSC-34 cells (Cedarlane Laboratories, CLU140) were cultured in DMEM supplemented with 10% FBS, 1% Sodium pyruvate and 100 U/mL P/S in non-differentiating conditions. All cell lines were confirmed to be mycoplasma-free by Eurofins Genomics (Luxembourg, EU).
The plasmid construct with 32×CCCCGG repeats containing the S1m aptamer on the 3′-end (pcDNA3.1-32×C4G2-S1m) and control constructs—a partial sequence (369 bp) of red fluorescent protein with the S1m aptamer on the 3′-end (pcDNA3.1-RFP-S1m) and a construct containing only the S1m aptamer (pcDNA3.1-S1m)—were previously described64. Plasmids with short 8x and 24x C4G2 repeats were cloned from previously described G4C2 repeats15. The plasmid construct PB-513B-1-GFP-MmPheT413G containing mutated FARSA (MmPheT413G) was obtained from dr. Tony Wyss-Coray lab and was previously described38. Sequence encoding for mutated FARSA was cloned into pcDNA 3.1. vector tagged with HA-tag. All the sequences were confirmed by sequencing (Microsynth AG, Switzerland, EU).
Preparation of RNA constructs
For RNA preparation, all constructs were linearized at the restriction site on the 3′-end of the S1m aptamer. The constructs contained the T7 promoter for in vitro transcription to RNA, which was performed with the TranscriptAid T7 High Yield Transcription Kit (K0441, Thermo Fisher Scientific, Waltham, Massachusetts, USA). Single-strand Binding Protein from Escherichia coli (S3917, Sigma Aldrich, St. Louis, Missouri, USA) was added to the reaction (7.5 μg per 1 μg of DNA) to facilitate the transcription of GC-rich hexanucleotide repeats. The reactions were performed for 6 h at 37 °C. The integrity of the prepared RNA constructs was assessed with agarose gel electrophoresis.
Tissue and cell extraction
Mouse brains obtained from Mus Musculus strain FVB/PyMT, age 2 y, female, were obtained under the approval of the Veterinary Administration of the Ministry of Agriculture and the Environment, Slovenia. Procedures for animal care and use were in accordance with the “PHS Policy on Human Care and Use of Laboratory Animals” and the “Guide for the Care and Use of Laboratory Animals” (NIH publication 86-23, 1996). Mouse brain tissue was processed and nuclear and cytoplasmic fractions were prepared as previously described20. Mouse brain tissue (300 mg per experiment) was homogenized in 5 mL of ice-cold buffer A [10 mM HEPES, 10 mM KCl, 1.5 mM MgCl2, protease inhibitors (Roche, Basel, Switzerland)] with glass pestle tissue grinder on ice. The homogenate was incubated on ice for 75 min and centrifuged for 10 min at 3000 × g at 4 °C. The pellet (nuclear fraction) was washed 3× with 1.5 mL of buffer A and centrifuged for 10 min at 3000 × g at 4 °C each time. The pellet was then re-suspended in 1.25 mL of RNA lysis buffer [50 mM HEPES, 400 mM KCl, 10 mM MgCl2, 1% Igepal], incubated on ice for 10 min, and sonicated (30 s, 0.5 cycle, 90% amplitude). Both cytosol and nuclear fractions were centrifuged for 10 min at 16,000 × g at 4 °C, and supernatants were collected. The nuclear fraction was diluted 4× with dilution buffer [50 mM HEPES, 10 mM MgCl2, 0.33% Igepal CA-630]. The RiboLock RNase Inhibitor (Fermentas, Waltham, Massachusetts, USA) was added to both fractions at a 1:400 (v/v) ratio. Aliquots for western blot lysate controls were taken at this point.
For interaction validation studies with RNA pull-down, frontal cortex (300 mg per experiment) from a control case (male, 63 y) was prepared without fractionation. Fresh-frozen post-mortem tissue was obtained from the Brain Bank associated with the DZNE and University Hospital of Tübingen (IEC Project Numbers 252/2013BO1 and 386/2017BO1). The tissue was homogenized in RNA lysis buffer as previously described and then diluted 4× with dilution buffer. Same was done for HEK293 cells. HEK293T cells were previously transfected with pcDNA3.1.-mFARSA-HA construct using PolyJet reagent (SignaGen, Frederick, USA), lysed with RNA lysis buffer after 24 h and 4x diluted in dilution buffer.
For Phe-rich protein expression analysis, the study cohort consisted of 12 cases with a C9orf72 repeat expansion mutation presenting with ALS (n = 4), FTD/ALS (n = 5) or FTD (n = 3) and 12 control cases with TDP-43 pathology in the absence of a C9orf72 repeat expansion mutation presenting with ALS (n = 7), ALS/FTD (n = 3) and FTD (n = 2). Details for cases are provided in Supplementary Table 4. Cerebellum samples were homogenized in RIPA buffer (50 mM Tris-HCl, 150 mM NaCl, 1% (v/v) octylphenoxy poly(ethyleneoxy)ethanol (IPEGAL), 5 mM EDTA, 0.5% (w/v) sodium deoxycholate, 0.1% (w/v) sodium dodecyl sulfate (SDS), pH 8.0) at 1 g / 2 ml ratio. Lysates were passed through 18- and 21- Gauge needles and sonicated to shear nucleic acids. Cellular debris was removed by centrifugation for 2 min at 3000 × g at 4 °C and supernatant collected as RIPA lysate.
Knockdown assay
NSC-34 cells were differentiated in differentiating medium (DMEM F12 + 0,5% FBS + 1 x MEM + 1% P/S + 10 μM retinoic acid) modified according to65 seven days prior to lentiviral transduction with second generation lentiviruses prepared in HEK293T cells. At 70% confluency HEK293T cells were co-transfected using PolyJet (SignaGen Laboratories, Frederick, USA) reagent with pMD2.G (Addgene #12259), psPAX2 (Addgene #12260) and suitable shFARSA RNA (Sigma-Aldrich mission plasmids 07082112MN: 1584s21c1 for NSC34 and 1357s1c1 for HEK293) or shScramble (Addgene #1864) in 1:2:3 ratios according to the manufacturer’s instructions. 6 h later medium was exchanged with HEK293 or NSC-34 growth medium. After 48 h the supernatant was collected and filtered through a 0.45 um cellulose acetate membrane and added to HEK293 (1:3 dilution in growth medium) or differentiated NSC-34 (1:1 dilution in differentiating medium) cells. After 24 h the medium was changed and cells were incubated for additional 48 h when they were fixed for IF or collected for WB and qPCR analysis.
RNA pull-down assay
For the RNA pull-down assay, 100 pmol of RNA construct per reaction diluted in RNA-binding buffer [50 mM HEPES (pH 7.4), 100 mM KCl, 10 mM MgCl2, 0.5% Igepal CA-630] was incubated with 50 µL of streptavidin beads (Promega, Madison, Wisconsin, USA) for 30 min at room temperature (RT). RiboLock RNase inhibitors were used throughout the experiment (1:100). The supernatant was removed, and the beads were washed 2× with 500 μL of RNA-binding buffer; tRNA from baker’s yeast (R8508, Sigma Aldrich, St. Louis, Missouri, USA) was added to cytoplasmic and nuclear mouse tissue fractions and to lysates from human postmortem brain tissue. The beads with bound RNA were rotated with 1 mL of cytoplasmic or nuclear fraction for 4 h at 4 °C. The beads were washed 4× with 500 μL of RNA-binding buffer. Elution was performed with 3U RNase I (EN0601, Thermo Fisher Scientific, Waltham, Massachusetts, USA) for 10 min at 37 °C. Cytoplasmic and nuclear mouse tissue fractions (two independent experimental repeats), lysates from human postmortem brain tissue (two independent experimental repeats), HEK293 (three independent experimental repeats) and HEK293T (two independent experimental repeats) cell lysate were used for RNA pull-down assay.
Mass spectrometry
Mouse brain samples from RNA-pull down assay were prepared in 2× sodium dodecyl sulfate (SDS) loading buffer and 0.2 M dithiothreitol (DTT) and incubated for 5 min at 95 °C. The samples were then separated with SDS-PAGE, and the gels were silver stained. The selected bands were cut out and digested using a ProGest digestion robot (DigiLab)66. Briefly, the gel bands were diced, put into the pink reaction plate, and destained with destaining solution (15 mM potassium ferricyanide, 50 mM sodium thiosulfate) for 15 min. After washing with 50 mM ammonium bicarbonate (ABC) then acetonitrile (ACN) two times, the proteins were reduced with 10 mM DTT at 37 °C for 10 min and alkylated with 50 mM iodoacetamide for 15 min at RT. This was followed by two washes with 50 mM ABC and ACN. The proteins were digested with trypsin (Pierce, Thermo Fisher Scientific, Waltham, Massachusetts, USA) overnight at 37 °C. The digested peptides were extracted from the gel pieces by sequentially adding 25 mM ammonium bicarbonate, acetonitrile, and 10% formic acid and then collected into a blue collection plate. The peptides were freeze-dried and resuspended in 2% ACN in 0.05% trifluoroacetic acid (TFA). The samples were separated with nano-flow liquid chromatography on a reverse-phase column (C18 PepMap100, 3 μm, 100 Å, 50 cm; Thermo Fisher Scientific) using 80 min gradient (0–37 min, 4% B – 30% B; 37–40 min, 30% B – 40% B; 40–45 min, 40% B – 99% B; 45–50 min, 99% B; 50–80 min, 4% B. Solvent A = 2% ACN, 0.1% FA in H2O; B = 80% ACN, 0.1% FA in H2O). Spectra were collected from an Orbitrap mass analyzer (Q Exactive HF, Thermo Fisher Scientific, Waltham, Massachusetts, USA) using a full ion scan mode over the m/z range 350–1600 and resolution 60,000. For each full scan, MS/MS scans were performed on the 15 most abundant ions using higher-energy collisional dissociation (HCD) and measured with Orbitrap (resolution 15,000) with dynamic exclusion enabled (40 s).
Data were analyzed with Proteome Discoverer (version 2.1, Thermo Fisher Scientific) against UniProt/SwissProt mouse database (version 2017_01, 16,844 protein entries) using Mascot (version 2.6.0, Matrix Sciences). The search results were loaded into Scaffold (version 4.8.7, Proteome Software). Carboxyamidomethylation of cysteine was used as a fixed modification, and oxidation of methionine was used as a variable modification. The mass tolerance was set at 10 ppm for the precursor ions and at 20 mmu for fragment ions. Two missed cleavages were allowed. The search results were loaded into Scaffold software (version 4.8.7, Proteome Software), and protein and peptide probabilities were calculated. Assignments were accepted with >95.0% peptide probability, >99.0% protein probability, and a minimum of two peptides per protein. The mass spectrometry was performed on one sample from each condition as a screening step for possible binding proteins. Protein candidates with correct molecular weight as indicated on the SDS-PAGE gels, spectral count >20 and fold change >3 between C4G2 and S1m control were further validated by Western blot.
Twelve independent biological samples: six C9orf72-patient derived and six control lymphoblastoid cell lines were used for MS analysis of whole proteome expression in one technical replicate. 1 × 106 cells were washed 3 times with ice cold PBS and collected in RIPA buffer (50 mM Tris/HCl, pH 8; 150 mM NaCl; 0,5 Mm Sodium deoxycholate; 0,1% SDS and 1% Triton X-100). They were centrifuged at 12,000 × g for 10 min and supernatant was collected for MS analysis.
Protein concentration was measured using BCA method and 50ug of proteins from each sample were used. Protein samples were denatured in 6 M urea / 2 M thiourea and reduced by 10 mM DTT at 37 °C for 1 h. Then samples were alkylated using 50 mM iodoacetamide for 1 h in the dark at room temperature. After acetone precipitation over night at −20 °C, the protein pellets were resuspended in 100 mM TEAB (pH = 8.5) and digested using trypsin / lysC (Promega, protein: enzyme ratio = 25:1) at 37 °C overnight. The digestion was stopped by 1% trifluoroacetic acid and peptides were purified using C18 cartridges on Bravo AssayMAP robot (Agilent). The cleaned peptides were dried and resuspended in 2% acetonitrile (ACN), 0.1% formic acid (FA) and separated by nano-flow HPLC (U3000 RSLCnano, Acclaim PepMap100 C18 column, 75 μm × 50 cm, Thermo Fisher Scientific) using 2 h gradient and analysed using Orbitrap Fusion Lumos MS with FAIMS Duo Pro (3 different CV: −40 V, −50 V, −60 V).
RAW data were searched against human protein database (UniProt/SwissProt Release 2022_01, 20376 protein entries) combined with FBS contamination database (249 protein entries) using Mascot algorithm (version 2.6.0, Matrix Science) and Proteome Discoverer (version 2.4.1.15, Thermo Fisher Scientific) with the following parameters: trypsin was used as enzyme and 2 missed-cleavages was allowed; precursor mass tolerance was set at 10ppm and fragment mass tolerance was 0.8 Da; Carbamidomethylation on cysteine was set as static modification and oxidation on methionine as dynamic modification. Protein table was exported for further analysis (Supplementary Data 1).
Analysis of ratio between downregulated and upregulated proteins in comparison to Phe-content was performed on all proteins that had log 2(Fold Change) of at least 0,15 and that we know the percentage of Phe (1512 proteins) (Supplementary Data 1). Each protein was associated with the % of Phe in its sequence according to39. We calculated number of downregulated and upregulated proteins in each interval (0−2%, 2−4%, 4−6%, 6−8%, over 8%).
The proteomics data were deposited to the ProteomeXchange Consortium via the PRIDE67 partner repository with dataset identifier PXD024527 and PXD042474.
RNA immunoprecipitation
For RNA immunoprecipitation (RIP) assay C9orf72 patient-derived fibroblasts were used. Cells were washed twice with cold PBS and lysed in ice-cold lysis buffer [50 mM Tris-HCl, pH 7.4, 100 mM NaCl, 1% Igepal CA-630, 0.1% SDS, 0.5% sodium deoxycholate]. Protease inhibitors (PI) and RiboLock RNase Inhibitor were added to the lysis buffer. Cells were incubated in lysis buffer at 4 °C for 30 min, sonicated (3 × 10 s, 0.5 cycle, 90% amplitude), and centrifuged. Supernatant was transferred to a new tube and 3 μg of either FARSA antibodies or control Normal Rabbit IgG antibodies were added to the lysate and incubated over night at 4 °C. Dynabeads Protein A (10001D, Thermo Fisher Scientific, Waltham, Massachusetts, USA) were washed twice with lysis buffer and then incubated with the lysate for 30 min at 4 °C. Three washes were performed with wash buffer [50 mM Tris-HCl, pH 7.4, 1 M NaCl, 1% Igepal CA-630, 0.1% SDS, 0.5% sodium deoxycholate]. 2×SDS loading buffer with 200 mM DTT was added to 10% of the beads and incubated at 95 °C for 5 min. RNA was isolated from the RIP reaction with TRIzol. For cDNA synthesis SuperScript IV Reverse Transcriptase (18090010 Thermo Fisher Scientific, Waltham, Massachusetts, USA) was used. Reaction conditions and primers for antisense RNA were used as previously described17. Detection was carried out with qPCR analysis using FastStart Universal SYBR Green Master (Rox) (Roche, Switzerland, EU) and a StepOnePlus Real-Time PCR system (Applied Biosystems, USA). Cycling conditions were: 95 °C for 10 min, 45 cycles at 95 °C for 10 s, and 62 °C for 35 s, followed by a melting curve analysis. Primer PCR efficiencies were at least 80% and a single melting peak was present for each primer pair. Three independent experiments on C9orf72 patient-derived fibroblasts were performed.
Western blot analysis
Protein samples were prepared in RIPA buffer (50 mM Tris/HCl, pH 8; 150 mM NaCl; 0,5 mM Sodium deoxycholate; 0,1% SDS and 1% Triton X-100 + protease inhibitors) and 2×SDS loading buffer with 200 mM DTT, incubated at 95 °C for 5 min and separated on 12% SDS precast gels (Invitrogen, Carlsbad, California, USA) or 12% stain free gels (Bio-Rad, Hercules, California, USA) at 125 V. The samples were wet-transferred onto nitrocellulose membrane (GE Healthcare, Chicago, Illinois, USA) at 200 mA for 90 min or semi-dry transferred (Bio-rad, Hercules, California, USA). Blocking was performed for 1 h at RT in blocking solution (5% skim milk in TBS with 0.05% Tween-20 (TBST) or 2.5% skim milk + 1% BSA in TBST for TSPAN5, GOLT1B, ALG10B and GAPDH), incubations with the primary and secondary antibodies were performed as suggested by the manufacturer. Clarity Max Western ECL Substrate (Bio-Rad, Hercules, California, USA) was used for signal detection. The GelDoc System ImageLab software (both from Bio-Rad, Hercules, California, USA) and imageJ (https://imagej.nih.gov/) were used for image acquisition and densitometric analysis, respectively.
RNA fluorescent in situ hybridization (RNA-FISH) and immunofluorescence staining (IF)
Cells were fixed on coverslips with 4% paraformaldehyde for 15 min, washed with PBS, and permeabilized with 0.1% Triton in PBS for 5 min. RNA-FISH was performed as previously described20,64. Shortly, the coverslips were incubated in pre-hybridization solution [40% formamide, 2× saline sodium citrate (SSC)] for 20 min at RT and then in hybridization solution [2×SSC, 100 μg/mL tRNA (R8508, Sigma), 10% dextran sulfate, 25% formamide] for 20 min to 1 h at 59 °C. The locked nucleic acid (LNA) probes were dissolved and heated in hybridization solution at 95 °C for 5 min. The coverslips were then incubated with 40 nM LNA probes at 59 °C overnight. Stringency washes were as follows: 1×5 min in 2×SSC, 0.1% Tween-20 at RT and 3×10 min in 0.1×SSC at 59 °C. This was followed by the IF protocol. Coverslips were blocked in 10% goat serum (Sigma Aldrich, St. Louis, Missouri, USA) or in 3% biotin-free bovine serum albumin (Carl Roth, Germany, EU) for 30 min at RT. Incubation with primary antibodies diluted in blocking solution was performed for 1.5 h at RT and incubation with secondary antibodies was performed for 1 h at RT. The coverslips were mounted using ProLong Gold Antifade reagent (P36930, Thermo Fisher Scientific, Waltham, Massachusetts, USA). The following LNA probes were purchased from Exiqon (Qiagen, Germany, EU): /5TYE563/GGGGCCGGGGCCGGGG, /5Biosg/GGGGCCGGGGCCGGGG. For RNA-protein fluorescence co-localization, the ImageJ Plot profile function was used.
RNA-protein proximity ligation assay (PLA)
The RNA-protein PLA was optimized from previously described protocols43,68. The hybridization solution for RNA-ISH contained 50% formamide, 5×SSC, 1×Denhardt’s solution, 0.1% Tween, 0.1% Chaps, 5 mM EDTA, 0.1 mg/mL tRNA, and 0.1 mg/mL heparin. The steps for RNA-ISH were the same as for RNA-FISH. Coverslips were then blocked in 3% biotin-free bovine serum albumin (Carl Roth, Germany, EU) for 30 min at RT. Incubation with primary antibodies against biotin (detecting LNA probe) and against target antibody was performed for 1.5 h at RT. PLA antibody probes (Duolink, Sigma Aldrich, St. Louis, Missouri, USA) were incubated on slides for 1 h at 37 °C. The PLA protocol from here onward was performed according to the manufacturer’s instructions. The same antibodies and dilutions were used as for IF. For the PLA signal count, the ImageJ find maxima function was used on each slice of the z-stack, and counted signals were summed for each cell through the stacks.
Confocal microscopy imaging
Images were acquired with a Zeiss LSM 710 inverted confocal laser scanning microscope with a Plan-Apochromat 63× and 1.4 NA M27 oil immersion objective using immersion oil (Carl Zeiss). DAPI, Alexa Fluor 488, Alexa Fluor 555, Alexa Fluor 647 and 5TYE563 were excited at 405, 488, 543, 647 and 543 nm, respectively. The zoom factor was set to 1–4×, and X- and Y-scanning sizes were each 1024 pixels. All other images except for HEK293 IF were acquired as z-stacks, and the z-scanning size was 0.979–2 μm.
In vitro aminoacylation assay
Recombinant FARSA and FARSB proteins from Drosophila were expressed in the E. coli strain Rosetta (Novagen) and then purified69. For this, the Drosophila α-PheRS (FARSA) cDNA was cloned with a His tag at the N-terminal end into the pET-28a plasmid expression vector (Novagen). The α-PheRS (FARSB) cDNAs was cloned into the pET LIC (2A-T) plasmid (Addgene). The two subunits were then co-expressed in the E. coli strain Rosetta with isopropylthiogalactoside (IPTG, 1 mM) induction at 25 °C for 6 h. The IPTG was added when the OD600 of bacteria reached 0.6-0.8. Proteins were purified with Ni-NTA affinity resin (Qiagen). The aminoacylation assay protocol from Lu and colleagues was then followed36. This assay was performed at 25 °C in a 100 μl reaction mixture containing 50 mM Tris-HCl pH 7.5, 10 mM MgCl2, 4 mM ATP, 5 mM β-mercaptoethanol, 100 μg/ml BSA, 4.375 μg PheRS/FARS protein, 3 U/ml E. coli carrier tRNA, 5 μM [3H] L-Phe and 1 μM tRNAPhe from brewer’s yeast (Sigma, US). The inhibitory effect of RNA C4G2 or RFP was tested by pre-incubating for 10 min each RNA at two different concentrations (0.4 ng/uL and 4 ng/uL) in the master mix before adding tRNAPhe and [3H] L-Phe to start the reaction. In each experiment, a 10-μl aliquot was removed at six different incubation time points, spotted on a Phe saturated Whatman filter paper disc (the discs were soaked in 0.2 M Phe solution for at least 2 h at RT) and washed three times with ice-cold 5% trichloroacetic acid and once with ice-cold ethanol. A blank paper disc without spotting and another with spotting the enzyme-free reaction were used for detecting background signals. After filter discs were dried, they were immersed in PPO Toluol (Sigma, US) solution in plastic bottles and the radioactivity was measured by scintillation counting.
tRNA aminoacylation assay in cells
The assay for determining tRNA aminoacylation levels has been described previously in Loayza-Puch37. Lymphoblastoid cells (5–10 million) were harvested, washed with cold PBS, and resuspended in ice-cold 0.3 M sodium acetate/acetic acid (NaOAc/HOAc; pH 4.5). The RNA was isolated using TRIzol and resuspended in 10 mM NaOAc/HOAc (pH 4.5). The RNA samples (5 μg) were split into two halves that were either oxidized with 50 mM sodium periodate or incubated with 50 mM sodium chloride in 100 mM NaOAc/HOAc (pH 4.5) for 15 min at RT. The reactions were quenched with 100 mM glucose for 5 min at RT and purified in G25 columns (GE Healthcare, Chicago, Illinois, USA) following manufacturer’s instructions. Purity of the RNA was measured by using Nanodrop 2000, with 260/280 ratio ∼2. The RNA was spiked with 7.3 ng yeast tRNAPhe (R4018, Sigma Aldrich, St. Louis, Missouri, USA) per 1 μg of RNA. Deacylation of tRNA was performed in 50 mM Tris-HCl (pH 9) at 37 °C for 30 min. The RNA was precipitated, resuspended in diethyl pyrocarbonate (DEPC)-treated water, and ligated to the 3’adaptor (5′-/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/-3′) with T4 RNA ligase 2 truncated (M0242, New England Biolabs, Massachusetts, USA) for 2 h. Then, the RNA was purified with phenol-chloroform extraction and reverse transcribed with TGIRT™-III enzyme (InGex, Missouri, USA) and the primer 5‘ GCCTTGGCACCCGAGAATTCCA 3‘. The RT was performed in 20 µL reactions. First, 5×TGIRT buffer, template RNA (300 ng), RT primer (1 µM), MgCl2 (50 mM), of RNase free water were mixed, heated to 75 °C for 3 min, and incubated on ice for 1 min. Then TGIRT-III enzyme, RNasIn PLUS (Promega Madison, Wisconsin, USA), and 100 mM DTT were added to the reaction mix and incubated at RT for 20 min. After addition of dNTP mix (500 µM) the reaction mix was incubated at 57 °C for 60 min. The absence of DNA was assessed with a no-reverse transcription assay. The synthesized cDNA was diluted 1:5 and qPCR cycling conditions were: 95 °C for 10 min, 45 cycles at 95 °C for 10 s, and 62 °C for 35 s, followed by a melting curve analysis. Primer efficiencies were at least 80% and a single melting peak was present for each primer pair. The following primers were used: forward Phe(GAA)-tRNA primer GCCGAAATAGCTCAGTTGGGAG; forward yeast (spike-in) Phe-tRNA primer GCGGAYTTAGCTCAGTTGGGAGAG; Asn(GTT)-tRNA GTCTCTGTGGCGCAATCGGT, Leu(CAA)-tRNAGTCAGGATGGCCGAGTGGTCTA, Leu(CAG)-tRNA GTCAGGATGGCCGAGCGGTCTA, Pro(CGG)-tRNA GGCTCGTTGGTCTAGGGGTATG, and reverse primer GCCTTGGCACCCGAGAATTCCA.
Amino acid mass spectrometry analysis
Cell pellets were resuspended in 250 µL of distilled water and sonicated for 2 min using a Labsonic M probe sonicator (Stratorius Stedim Biotech, Göttingen, Germany). After centrifugation at 16,800 × g for 2 min at RT, supernatants were used for amino acid analysis with the aTRAQ Kit for Physiological Fluids (Sciex, Massachusetts, USA). Samples were prepared as described in the protocol. Briefly, after precipitation of proteins with sulfosalicylic acid, the amino acids were derivatized with the aTRAQ reagent. Derivatization was stopped with hydroxylamine, and the aTRAQ internal standard was added. The samples were analyzed in multiple reaction monitoring mode with the AB Sciex 3200 Qtrap tandem mass spectrometer (Sciex, Massachusetts, USA), Perkin Elmer Series 200 HPLC system (Perkin Elmer, Massachusetts, USA). Chromatographic separation of derivatized samples was achieved at 50 °C on a C18 4.6 × 150 mm column from the aTRAQ kit. The mobile phase A consisted of water (LiChrosolv®, Merck, Darmstadt, Germany), and the mobile phase B consisted of methanol (LC-MS Reagent, J.T.Baker, Deventer, The Netherlands); both contained 0.1% formic acid and 0.01% heptafluorobutyric acid (both from Sciex, Massachusetts, USA).
Phe-rich and stress related protein mRNA expression level analysis
Whole RNA was isolated using TRIzol from six control and six C9orf72 patient-derived lymphoblastoid cell lines, three independent knockdown experiments with three technical replicates of shScramble and shFARSA treated HEK293 and differentiated NSC-34 cell lines 3 days post transduction. 3 μg of total RNA was treated with DNaseI (Roche, Basel, Switzerland) and incubated for 30 min at 37 °C and 10 min at 75 °C. RNA was cleaned using phenol-chloroform extraction. cDNA was synthesized with High capacity cDNA RT kit (Applied biosystems, Waltham, Massachusetts, USA). Reverse transcription was performed at 25 °C for 10 min followed by 120 min on 37 °C and 5 min at 85 °C. The absence of DNA was confirmed with a no-reverse transcription assay. cDNA was diluted 1:50 and qPCR analysis were performed with cycling conditions: 95 °C for 10 min, 45 cycles at 95 °C for 15 s, and 58 °C or 60 °C for 60 s, followed by a melting curve analysis. Primer efficiencies were at least 90% and a single melting peak was present for each primer pair. Primers ALG10B-2; GAPDH-1; GOLT1B-1; PXMP2-2; TSPAN5-2; ACTB-1 were obtained from Sigma Aldrich (St. Louis, Missouri, USA), KiCqStart SYBR Green Primers. Primers for evaluating stress response listed in Supplementary Table 5 were purchased from Kemomed (Ljubljana, Slovenia).
Click chemistry analysis of phenylalanine abundance in the proteome
Stable HEK293T cell line expressing mutated FARSA protein that enables incorporation of azido-Phe into proteome of the cell was established using construct for piggybac transposase and PB-513B-1-GFP-MmPheT413G. Both plasmids were co-transfected into HEK 293T cells using Lipofectamine 3000 and incubated for 72 h before puromycin selection (10 μg/μl). The presence of the construct was observed as continuous expression of GFP.
Cells were transfected with pcDNA3.1 construct encoding S1m, RFP-S1m and 32×C4G2-S1m using Polyjet reagent (SignaGen Laboratories, Frederick, USA). 24 h later azido-Phe (JennaBioscience, Jena, Germany) was added to a final concentration of 125 μM. After 24 h incubation cell lysates were collected in lysis buffer (1% SDS in PBS with protease inhibitors), sonicated 3 × 10 s at amplitude of 80%. 25 μg of protein was added to the copper-catalyzed Click reaction kit (Jena, Germany). The reaction was done according to the manufacturer’s protocol. Alexa 555 alkyl (Invitrogen, Waltham, Massachusetts, USA) was used for staining and imaged on GelDoc System (Bio-Rad, Hercules, California, USA). Gels were stained with colloidal Coomassie dye G-250 (Gelcode Blue stain reagent, Thermo Fisher Scientific, Waltham, Massachusetts, USA) according to the manufacturer’s protocol and imaged on GelDoc System (Bio-Rad, Hercules, California, USA).
Quantification and statistical analysis
For the antisense RNA foci-FARSA protein co-localization studies, three C9orf72 patient-derived fibroblast cell lines were used, and the RNA-FISH/IF experiments were performed independently at least two times for each cell line. The numbers of cells and foci analyzed in each cell line were at least 40 and 250, respectively.
For RNA-protein PLA, three C9orf72 patient-derived and three control fibroblast cell lines, three C9orf72 patient-derived and three control lymphoblastoid cell lines, and one C9orf72 patient-derived and one control iPS cell line were used. The experiments were performed independently at least two times for each cell line. The numbers of cells analyzed in each independent experiment for fibroblasts were at least 100, for lymphoblastoid cells at least 200, and for iPSCs at least 300.
For the tRNA aminoacylation assay, four different C9orf72 patient-derived and four different control lymphoblastoid cell lines were used. The experiment was performed in four independent replicates and three technical replicates were performed for the qPCR analysis of each experiment. The ddCt method was used for qPCR data analysis and the yeast tRNAPhe spike-in was used for normalization.
The amino acid content was determined in six different C9orf72 patient-derived and six different control lymphoblastoid cell lines. The experiment was performed once for each cell line. The results were compared between C9orf72 patient-derived and control lymphoblastoid cell lines.
The expression of FARSA was determined in six different C9orf72 patient-derived and six different control lymphoblastoid cell line lysates. The experiment was performed in two technical replicates for each cell line. The results were compared between C9orf72 patient-derived and control lymphoblastoid cell lines.
Phe incorporation experiments using click chemistry were repeated four times. Expression level was measured using ImageJ and normalized to whole protein expression determined by colloidal Coomassie dye G-250. Data were reported relative to S1m.
Densitometry signals for each Phe-rich protein were always normalized to whole protein loading from stain free membrane. In knockdown experiments four (HEK293) or three (NSC-34) independent experiments with three technical replicates were done. Each independent experiment was analyzed on one membrane (controls + KD samples). Each value was reported relative to shScramble average and ratios were compared between blots. Statistical significance was calculated using nested t-test analysis in GrafpadPrism version 9.5.0. for Windows, GraphPad Software, San Diego, California USA, www.graphpad.com on all included technical replicates and biological repeats. Six control and six C9orf72 patient-derived lymphoblastoid cell lines (each representing one biological repeat) were compared on the same membrane. Experiments were repeated in two technical repeats. Unpaired Student’s t-test was performed between 6 biological repeats (significance marked on graphs) and additional statistical analysis was done between the dependent technical repeats with mixed model analysis in R to eliminate technical variations. Two models were constructed for each dependent variable and their parameters estimated based on the western blot densitometry data. In the first model (model A) experiment (first/second experiment) was a fixed factor and each lymphoblastoid cell line was a random factor. In the second model (model B) additional parameter to determine C9orf72 patient-derived or control group was included and used as a fixed factor. Model B was compared against the model A using likelihood ratio test to assess differences between the C9orf72 patient-derived and control cells with respect to the mean values of the protein expression levels.
Twenty-four human post mortem tissue samples were analyzed on two membranes: 6 C9orf72-mutation positive samples and 6 C9orf72-mutation negative samples on each. Each sample was normalized to C9orf72-mutation negative samples average. Ratios were compared between membranes.
qPCR analysis of Phe-rich mRNA expression level was done in three technical repeats for each sample using six control and six C9orf72 patient-derived lymphoblastoid cell lines. qPCR analysis of stress related proteins was done on three knockdown experiments with three replicates for each sample. Changes in expression levels were calculated using relative ΔΔcq qPCR analysis and normalized to ACTB transcript.
Statistical significance for previously described experiments unless otherwise specified was determined with the unpaired Student’s t-test in Microsoft Excel 2010. A p-value (two-sided) of <0.05 was considered significant. All values are presented as means ± standard errors of the mean (s.e.m.), and statistical significance is indicated with * (p < 0.05), ** (p < 0.01), or *** (p < 0.001).
Reporting summary
Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.