Patient derived cells and cell culture
Patient derived ovarian cancer cell #1, patient derived ovarian cancer cell #2, patient derived ovarian cancer cell #3, and patient derived ovarian cancer cell #4 were isolated from four clinical ovarian cancer tissues which were histopathologically and clinically diagnosed at Jiangmen Central Hospital (Jiangmen, Guangdong, China). Each patient signed consent and was able to withdraw her consent at any time and this study was approved by the Institutional Research Ethics Committee of the Jiangmen Central Hospital. All patient derived cells were prepared from fresh ovarian cancer samples as previously described [51] and subjected to mycoplasma contamination.
Tissue specimens and Immunohistochemistry (IHC) analysis
The 117 paraffin-embedded surgical ovarian cancer samples with neoadjuvant chemotherapy were histopathologically and clinically diagnosed at Jiangmen Central Hospital (Jiangmen, Guangdong, China) or the First Affiliated hospital of Sun Yat-sen University (Guangzhou, Guangdong, China). This basic research study complied with all relevant ethical regulations involving human participants. Prior patient consent and approval were obtained from the Institutional Research Ethics Committee of the Jiangmen Central Hospital and the First Affiliated hospital of Sun Yat-sen University (Approval number: 2022-121).
IHC analysis was carried out to determine altered protein expression in indicated paraffin-embedded ovarian cancer tissues and followed by anti-DDUP antibody (1:100), overnight at 4 °C. According to the histopathological features and patient data of the tissues, the degree of immunostaining of formalin-fixed, paraffin-embedded sections was reviewed and scored separately by two independent pathologists. The scores were determined by the proportion of positively stained tumor cells coupled with the intensity of staining. The scores given by the two independent pathologists were combined into a mean score for further comparative evaluation. Tumor cell proportions were scored as follows: 0, no positive tumor cells; 1, <10% positive cells; 2, 10–35% positive tumor cells; 3, 35–75% positive tumor cells; 4, >75% positive tumor cells. Staining intensity was graded according to the following standard: 1, no staining; 2, weak staining (light yellow); 3, moderate staining (yellow-brown); 4, strong staining (brown). The staining index (SI) was calculated as the product of the staining intensity score and the proportion of positive tumor cells. Using the method of assessment, we evaluated protein expression in ovarian cancer tissues by determining the SI, with scores of 0, 2, 3, 4, 6, 8, 9, 12, and 16. Samples with a SI ≥ 8 were considered as high expression and samples with a SI < 8 were considered as low expression.
Apoptosis assay
The indicated cells were treated with CDDP (12.3 μM) for 24 h, then stained by using Annexin V/FITC Cell Apoptosis Kit (KeyGEN BioTECH, Nanjing, China) according to the manufacturer’s instructions. Briefly, indicated cells were washed with PBS and binding solution, subsequently added 5 μl of Annexin V antibody in binding buffer and addition of 2 μl PI, followed by incubation for 15 min. And flow cytometric analysis was performed with a CytoFLEX flow cytometer (BECHMAN COLTER, CA, USA) to determine the percentage of apoptotic cells. Data were analyzed using FlowJo10 (Tree Star, Ashland, Oregon, USA). The experiments were repeated at least three times.
Western blotting (WB) analysis
According to a standard protocol [52], western blot was carried out using the following antibodies: anti-DDUP (Sino Biological, Wuhan, China), anti-GAPDH (#60004-1-Ig, Proteintech,Wuhan, China), respectively. Full and uncropped western blots were provided in Supplementary Fig. 4.
Immunofluorescence (IF) staining
The indicated cells were plated on chamber slide cultures (Thermo Fisher Scientific, CA, USA), and then treated with anti-DDUP antibody (Sino Biological, Wuhan, China), anti-γH2AX antibody (#9718, Cell Signaling Technology, MA, USA), anti-PCNA (#2586, Cell Signaling Technology, MA, USA), anti-RAD18 antibody (#9040, Cell Signaling Technology, MA, USA), or anti-RAD51C antibody (PA5-77078, Invitrogen, USA). The photographs were taken with the Axion Vision Rel.4.6 computerized image analysis system (Carl Zeiss, Jena, Germany).
Plasmid and transfection
The PCR-amplified human CTBP1-DT sequence was subcloned and cloned into pSin-EF2-vector to produce the complete length of CTBP1-DT. By cloning the entire length of CTBP1-DT, the DDUP ORF with FLAG-tag expression plasmid was created. CTBP1-DT/ATG1m, CTBP1-DT/ATG2m, and CTBP1-DT/ATG1/2m mutation constructs in which the putative ORF start codon in the CTBP1-DT-psin EF2 vector was mutated to ATT. The DDUP/T174D mutant were created using the QuikChange Site-Directed Mutagenesis Kit (Agilent Technologies, CA, USA). Following the manufacturer’s instructions, vectors were transfected using Lipofectamine 3000 (Thermo Fisher Scientific, CA, USA).
MTT assay
The indicated cells were seeded in 96-well plates. Cells were exposed to the indicated concentration of CDDP 24 h and further cultured for 96 h in the fresh medium and then incubated with MTT solution (0.5 mg/ml, Sigma-Aldrich, St Louis, MO, USA) for 4 h at 37 °C. The culture medium was removed, and the cells were treated with 160 μl of dimethyl sulphoxide (Sigma-Aldrich, St Louis, MO, USA). Following the manufacturer’s instructions, measurements of absorbance were made at 490 nm using a Sunrise Microplate Reader (Tecan Sunrise, Switzerland). The CDDP half-maximal inhibitory concentration (IC50) values were determined using GraphPad Prism (Version 8.0.1). Results are representative of three independent experiments. Error bars indicate standard deviation (SD) of three biological replicates.
Drug combination analysis
To evaluate the effects of CDDP and Berzosertib combination treatment, the indicated cells were incubated with CDDP and Berzosertib and cell viability was analyzed using MTT assays. Briefly, 3500 cells/well were seeded into 96-well plates, grown for 24 h, and treated with CDDP (0.625, 1.25, 2.5, 5, 10, 20, 40, 80 μΜ) and Berzosertib (10, 20, 40, 80, 160, 320, 640, 1280 nM) alone at serial dilutions, or combination of CDDP (12.3 μΜ) with Berzosertib (10, 20, 40, 80, 160, 320, 640, 1280 nM) for 96 h. After that, 100 ml sterile MTT dye (0.5 mg/ml, Sigma) was added to each well for 4 h at 37 °C. Then, the media were removed and 150 μl dimethyl sulfoxide (Sigma-Aldrich, St Louis, MO, USA) was added. Finally, the absorbance of each well was measured at 570 nm using an EPICS XL flow cytometer (Beckman-Colter).To evaluate the synergistic effects of CDDP and Berzosertib combinations, synergistic drug interactions were calculate with the Chou and Talalay method using Compusyn software according to non-constant ratio design between drug combinations [31, 32]. The combination index (CI) [31] for drug combination is derived according to the equation below where n = number of drugs, fa = fraction affected, fu = fraction unaffected.
$${\rm{CI}}=\mathop{\sum }\limits_{j=1}^{n}\frac{{({f}_{a})}_{j}}{{({f}_{u})}_{j}}$$
The resulting combination index (CI) theorem offers quantitative definition for additive effect (CI = 1), synergism (CI < 1), and antagonism (CI > 1) in drug combination.
For mechanistic studies PDOVCs#3 and PDOVCs#4 cells were treated as described above but using the most synergistic drug combination of 12.3 μΜ CDDP and 80 nM Berzosertib.
Neutral comet assay
The comet assay was carried out in accordance with the manufacturer’s instructions (Trevigen, MD, USA) as described [53]. Briefly, after centrifugation, the indicated cells were collected and resuspended at 1 × 105 cells /ml in pre-cold PBS (Ca++ and Mg++ free). Combine cells in a 1:10 (v/v) ratio with molten LMAgaros and immediately transfer 50 μl evenly onto CometSlideTM. Immerse slides in 4 °C lysis solution overnight after the agarose has solidified at 4 °C for added sensitivity. Following that, slides were gently immersed in 50 ml of 1 × Neutral Electrophoresis buffer for 30 min after being removed from the lysis buffer. For the gel electrophoresis, add ~850 ml 4 °C 1 × Neutral Electrophoresis buffer to the slides, and set voltage at 1 volt per cm. After then, cells were fixed with 70% (v/v) ethanol and stained with SYBRTM Gold (#S11494, Invitrogen, CA, USA). Using the plugin OpenComet v1.3.1, DNA damage was quantified for 100 cells for each experimental condition by determining tail moment. The tail moment is calculated as percent DNA in the tail multiplied by the tail length. The tail moment was normalized to the control group to obtain relative tail moment. Results are representative of three independent experiments. Statistical analysis was done using the Student’s t test.
Determination of cisplatin-induced interstrand crosslinking
The determination of interstrand cross-linking was examined using a modification of single cell gel electrophoresis (comet assay). Briefly, the indicated cells were treated with CDDP (12.3 μΜ) alone or combination of CDDP (12.3 μΜ) and Berzosertib (80 nM) for 1 h. After that, cells were incubated in fresh medium for 7 h before cross-linking analysis. All CDDP-treated cells and one control were irradiated with IR (12.3 Gy) immediately before analysis to generate a random DNA strand breaks, one unirradiated control was also included. In accordance with the directions in the Comet Assay kit (Trevigen, 42150-050-K), we carried out an alkaline denaturing comet assay. For each slide, 100 cells were analyzed. Olive tail moment was obtained by using the OpenComet v1.3.1 plug in Image J [54]. The tail moment is calculated as product of percentage of DNA in the comet tail and distance between the head and tail. The presence of cross-linkings slows the migration of irradiated DNA during electrophoresis, resulting in a lower tail moment compared to control cells. The number of cross-linkings was calculated through the comparison of the tail moment of the irradiated CDDP-treated cells to the tail moment of the irradiated untreated cells and the unirradiated untreated controls. Cross-linking was calculated using the formula: % decrease in Olive Tail Moment = [1-(TMdi-TMcu)/ (TMci-TMcu)] × 100, where TMdi is the mean tail moment of drug-treated irradiated sample, TMcu is the mean tail moment of untreated, unirradiated control sample, and TMci is the mean tail moment of untreated, irradiated sample. In combination studies of CDDP and Berzosertib, the following formula was used: % decrease in Olive Tail Moment = [1-(TMdi-TMcu)/ (TMci-TMcu) + (TMdu-TMcu)] × 100, where TMdu is the tail moment of drug-treated, unirradiated samples to take into account any extra strand breaks produced by Berzosertib. Results are representative of three independent experiments.
RNA extraction, reverse transcription, and Polymerase Chain Reaction (PCR)
Total RNA was extracted from the indicated cells using Trizol (Thermo Fisher Scientific, CA, USA) reagent, and total mRNA reverse transcription was performed according to the manufacturer’s instructions using a GoScriptTM Reverse Transcription Mix kit (Promega, Beijing, China). PCR was then conducted on the reverse-transcribed cDNA. Using the FastStart Universal SYBR Green Master (ROX; Roche, Toronto, CA), real-time q-PCR was performed and quantified in the Bio-Rad CFX qRT-PCR detection system (Applied Biosystems Inc, CA, USA). Expression data were normalized to the geometric mean of housekeeping gene GAPDH to control the variability in expression levels and calculated as 2-[(Ct of gene) – (Ct of GAPDH)], where Ct represents the threshold cycle for each transcript. Primers as follows: CTBP1-DT Forward Primer: 5’-CCATCCTCTGCAGCAAGTCA -3’; CTBP1-DT Reverse Primer: 5’-CTCCGTTCTCAGTTGCCTGT-3’. Results are representative of three independent experiments.
Targeted gene disruption by CRISPR-Cas9
The CRISPR/Cas9 system was used to generate DDUP heterozygous knockout PDOVC cells. The corresponding gRNA1 (GGTTGGTGGAGTGCACAGGCAGG) and gRNA2 (TGCACAGGCAGGGACCTCACTGG) were designed and cloned into the GV392 plasmid, respectively, by GeneChem (Guangzhou, China). In brief, lenti-CRISPR virus was introduced into 3 × 105 indicated PDOVC cells. After 24 h, the infected cells were selected for 7 days with puromycin at 0.5 g/ml. Following that, #3 and #4 PDOVC/Cas9 cells were re-infected with the GV392-GFP-CTBP1-DT gRNA lentivirus at a MOI of 4 to ensure that >95% of cells were positive. Two days later, the infected cells were sorted using flow cytometry and single-cell cloned, the PDOVC#3/DDUP-/--1, PDOVC#3/DDUP-/--2, PDOVC#4/DDUP-/--1, and PDOVC#4/DDUP-/--2. PDOVC#3/DDUP-/--1 and DDUP-/--2 referred to PDOVC#3 single-cell clones 1 and 2, respectively. PDOVC#4/DDUP-/--1 and DDUP-/--2 referred to PDOVC#4 single-cell clones 1 and 2, respectively. DDUP depletion was validated by western blot.
Xenografted tumor models
All of the animal procedures and ethical approval were approved by the Sun Yat-sen University Animal Care Committee (SYSU-IACUC-2021-000674). Before tumor cell/tissues transplantation, mice were randomized into different groups (six in each group) according to their body weight to ensure that there were weight-induced differences. To authentically mimic the ovarian cancer growth in patients, we generated a patient-derived xenografts (PDX) tumor model beneath the skin of female NOD-SCID IL-2rγ−/− (NSG) mice (4–8 weeks old). In brief, subcutaneously implanted fragments (1–3 mm3) of freshly isolated clinical ovarian cancer patient tissues. Two weeks after the tumor transplantation, the mice received systemic administration of various agents. Every other day, the body weight and tumor volume of the mice were assessed. The tumors’ dimensions were measured with a vernier caliper. Tumor volume was calculated using the formula: V = 0.5 × length × width2. Recipient mice bearing ~0.2 cm3 size of tumor were intraperitoneally treated with vehicle (control), Carboplatin (50 mg/kg), Berzosertib (60 mg/kg), or Carboplatin (50 mg/kg) combined with Berzosertib (60 mg/kg), three times per week up to 6 weeks. In the subcutaneously tumor model, cells stably expressing DDUP/WT or DDUP/mutant were subcutaneously inoculated into female NOD-SCID mice. When the tumor became palpable, the mice treated with combination of vehicle and Carboplatin (50 mg/kg), or combination of Carboplatin (50 mg/kg) and Berzosertib (60 mg/kg), three times per week up to 6 weeks.
These mice were immediately put to death at the conclusion of the treatment, and the tumors were collected, weighed, measured, and ready for additional examination. Tumor sections were stained by IHC using anti-DDUP antibody (Sino Biological, Wuhan, China), anti-ATR pS428 antibody (PA5-39773, Thermo Fisher Scientific, CA, USA), anti-γH2AX antibody (#9718, Cell Signaling Technology, MA, USA), anti-Ki-67 antibody (PA5-19462, Thermo Fisher Scientific, CA, USA) or TUNEL analysis (In Situ Cell Death Detection Kit, TMRred, Roche Applied Science) according to the manufacturer’s protocol. The images were captured using the AxioVision Rel.4.6 computerized image system (Carl Zeiss, Jena, Germany).
Fluorescence recovery after photo-bleaching (FRAP)
Fluorescence recovery after photo-bleaching (FRAP) was carried out using a Carl Zeiss LSM 880 with Airyscan confocal microscope (Carl Zeiss, Jena, Germany) and a 63× oil (NA1.4) objective. The indicated cells transfected with GFP-RAD18 alone or co-transfected with DDUP plasmids were cultured on 15 mm glass-bottom dishes (NEST, Wuxi, China). Following the acquisition of two prebleach images, the GFP-RAD18 fluorescence was then photo-bleached using scans with a 488 nm argon laser at 100% power. Images were captured at 400 s intervals for post-bleached recovery recording, and the fluorescence intensity within a specific region was measured every 80 s at 20% laser power. After subtracting the background, the fluorescence intensity was normalized to the pre-bleached signal. Results are representative of three independent experiments. Data were plotted using GraphPad Prism 8 software.
Statistical analysis
GraphPad Prism v.8.0.1 for Windows and Microsoft Excel 2016 were used for the statistical analysis. The average and standard deviation of at least three biological replicates are used to represent experimental data. The combination index was calculated using the method of non-constant ratio drug combination proposed by Chou and Talalay [31]. Statistical significance was defined as a P-value of 0.05 or less. Unpaired, two-tailed Student’s t tests were used for parametric data. The two-sided Mann-Whitney test was used for non-parametric data. A chi-squared test was used to analyze the relationship between DDUP expression and the clinic pathological characteristics. Statistical analyses were performed using the SPSS 11.0 statistical software package.